LXL04_023635 | RubberDandelionOmics

Gene overview

LXL04_023635

Reference: OH-1004 Chr: Chr05 Coordinates: 57880865-57884218 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1386 bp · LXL04_023635|LXL04_023635|OH1004|cDNA

ATGCATTTCCGAGAGAGAGGAAGACGACGGTGGAGGAAAAGACGCCAGTGGGTGGTTGGGTTTCCGGCGAGGGCTGACCTCCGGCGAACAACTGCCGACGTAGGTTTGAAAGTATTGTCGTCTCCGTTCTCTCTTCCTCGACCCCACGACTCTGCCACTCACTTTCTTCAACCAGTCGAGACACCACCACAGTATCGCACAACAGTAGCGACTCAACCTGCAGCCAGATCGCTCTCTTCTCCACCCAATTTCTTTCTGGA...

CDS

Download CDS FASTA

1386 bp · LXL04_023635|LXL04_023635|OH1004|CDS

ATGCATTTCCGAGAGAGAGGAAGACGACGGTGGAGGAAAAGACGCCAGTGGGTGGTTGGGTTTCCGGCGAGGGCTGACCTCCGGCGAACAACTGCCGACGTAGGTTTGAAAGTATTGTCGTCTCCGTTCTCTCTTCCTCGACCCCACGACTCTGCCACTCACTTTCTTCAACCAGTCGAGACACCACCACAGTATCGCACAACAGTAGCGACTCAACCTGCAGCCAGATCGCTCTCTTCTCCACCCAATTTCTTTCTGGA...

Protein

Download Protein FASTA

461 aa · LXL04_023635|LXL04_023635|OH1004|PROTEIN

MHFRERGRRRWRKRRQWVVGFPARADLRRTTADVGLKVLSSPFSLPRPHDSATHFLQPVETPPQYRTTVATQPAARSLSSPPNFFLETGTTSLFLKLLGVYMDRSTVVSFGIFNACAIVYWDVNLCSLHSRGHQGIYPCKKGYDDDILILLFLSPEITGTGLATRNALHLLEAAGRTDIPISCQLYGTSPSISTSFMSCSCTQIILFLHFLFLHVLRKPQRFELQTLSMGLMDLETRTSLNQSARMSGPHWSFATAQKLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023635`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023635

Location Chr05:57880865-57884218 (+)

Description Similar to T-complex protein 1 subunit epsilon

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g24510`	Molecular chaperone; assists the folding of proteins upon ATP hydrolysis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023635 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006457 protein folding Biological Process

GO:0007339 binding of sperm to zona pellucida Biological Process

GO:0009615 response to virus Biological Process

GO:0032212 positive regulation of telomere maintenance via telomerase Biological Process

GO:0050821 protein stabilization Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005813 centrosome Cellular Component

GO:0005832 chaperonin-containing T-complex Cellular Component

GO:0005874 microtubule Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0010494 cytoplasmic stress granule Cellular Component

KEGG gene cross-reference

ath:AT1G24510

mcf:101926268

rno:294864

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.402

Rank 1 · LXL04_023635 · OH-1004

Cytoplasm0.368

Rank 2 · LXL04_023635 · OH-1004

Mitochondrion0.136

Rank 3 · LXL04_023635 · OH-1004

Cell membrane0.107

Rank 4 · LXL04_023635 · OH-1004

Endoplasmic reticulum0.097

Rank 5 · LXL04_023635 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00118.30Cpn60_TCP1268-374 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023635	`PF00118.30`	Cpn60_TCP1	268	374	2.5e-23	83.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04450`	Arabidopsis thaliana	T-complex protein 1 subunit epsilon	80.702%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card