LXL04_023626 | RubberDandelionOmics

Gene overview

LXL04_023626

Reference: OH-1004 Chr: Chr05 Coordinates: 57124885-57136607 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2268 bp · LXL04_023626|LXL04_023626|OH1004|cDNA

ATGGCACCAGCGATGACCGCAGCCCAGATTCGACAGTTagtcgccaccgaggtgggccgggcCGTTGCCGATGAGGTgggccgagccgtctccgaggctatcccggagattatcacggcgatccgtgagcagctgGAAACCGTGATTGatgagcgggtgacggctgctatTGGGGCGAcgcagcagcatcaccagcgaggatTCTCCTAcaaggagttctcagcgtgctctcctcctctATTCCAGGGGAGCACTgaccc...

CDS

Download CDS FASTA

2268 bp · LXL04_023626|LXL04_023626|OH1004|CDS

ATGGCACCAGCGATGACCGCAGCCCAGATTCGACAGTTAGTCGCCACCGAGGTGGGCCGGGCCGTTGCCGATGAGGTGGGCCGAGCCGTCTCCGAGGCTATCCCGGAGATTATCACGGCGATCCGTGAGCAGCTGGAAACCGTGATTGATGAGCGGGTGACGGCTGCTATTGGGGCGACGCAGCAGCATCACCAGCGAGGATTCTCCTACAAGGAGTTCTCAGCGTGCTCTCCTCCTCTATTCCAGGGGAGCACTGACCC...

Protein

Download Protein FASTA

755 aa · LXL04_023626|LXL04_023626|OH1004|PROTEIN

MAPAMTAAQIRQLVATEVGRAVADEVGRAVSEAIPEIITAIREQLETVIDERVTAAIGATQQHHQRGFSYKEFSACSPPLFQGSTDPITCMRWISDVEGAFLTSDCPENAKVRCASNLLRDAANDWWTTWTKAMTNPEISEMPWEDFVTRFRTQYVPQVEMDRLAREFLTMEQTTESIPELNRKFNEMALFCPQYATDEGMKMARYTQMLRTDIREFVVAYPRTSLAELMDAARRREMEVEMQIQKRKATQALVPASSES...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023626`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_023626`
Location	Chr05:57124885-57136607 (-)
Description	Similar to gag-pol: Gag-Pol polyprotein (Simian immunodeficiency virus agm.grivet (isolate AGM gr-1)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_023626` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006310 DNA recombination Biological Process GO:0006508 proteolysis Biological Process GO:0015074 DNA integration Biological Process GO:0039657 symbiont-mediated suppression of host gene expression Biological Process GO:0039702 viral budding via host ESCRT complex Biological Process GO:0044826 viral genome integration into host DNA Biological Process GO:0046718 symbiont entry into host cell Biological Process GO:0075523 viral translational frameshifting Biological Process GO:0075713 establishment of integrated proviral latency Biological Process GO:0075732 viral penetration into host nucleus Biological Process GO:0019013 viral nucleocapsid Cellular Component GO:0020002 host cell plasma membrane Cellular Component
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.669

Rank 1 · LXL04_023626 · OH-1004

Nucleus0.443

Rank 2 · LXL04_023626 · OH-1004

Mitochondrion0.091

Rank 3 · LXL04_023626 · OH-1004

Cell membrane0.068

Rank 4 · LXL04_023626 · OH-1004

Endoplasmic reticulum0.061

Rank 5 · LXL04_023626 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03732.25PEG10_N-capsid78-156 aa

PF19259.5Ty3_capsid79-236 aa

PF00098.29zf-CCHC290-305 aa

PF00098.29zf-CCHC310-326 aa

PF17917.8RT_RNaseH476-514 aa

PF17919.8RT_RNaseH_2481-514 aa

PF17917.8RT_RNaseH647-685 aa

PF17919.8RT_RNaseH_2652-685 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023626	`PF03732.25`	PEG10_N-capsid	78	156	7e-13	49.4
LXL04_023626	`PF19259.5`	Ty3_capsid	79	236	1.2e-11	45.2
LXL04_023626	`PF00098.29`	zf-CCHC	290	305	5.7e-11	42.7
LXL04_023626	`PF00098.29`	zf-CCHC	310	326	5.7e-11	42.7
LXL04_023626	`PF17917.8`	RT_RNaseH	476	514	1.6e-13	51.4
LXL04_023626	`PF17919.8`	RT_RNaseH_2	481	514	3.9e-13	50.0
LXL04_023626	`PF17917.8`	RT_RNaseH	647	685	1.6e-13	51.4
LXL04_023626	`PF17919.8`	RT_RNaseH_2	652	685	3.9e-13	50.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card