LXL04_023564 | RubberDandelionOmics

Gene overview

LXL04_023564

Reference: OH-1004 Chr: Chr05 Coordinates: 50847607-50852890 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2241 bp · LXL04_023564|LXL04_023564|OH1004|cDNA

ATGACTGCGAGAAGTGGGAGAAGAGTAAGGGTCGTGTTTGAATTCGATGAGATGGCAACGGAGCGGGTTGGTTGGGTCAACTCTGGTGTACTCTCGATTTCTTCATCTTTCTCCAACCGAAGAGGAGTGAGGTTGACTCTGAAATCCGTTCGAATCACGCTGCCGATCATGGCAACTAGGAAAAATCTGAGCACAACCGATCACCTCCGTCATGTGGAGTCAATGTCGACTCTGCCGTCGGGTGCCGGCAAGATACCAAA...

CDS

Download CDS FASTA

2241 bp · LXL04_023564|LXL04_023564|OH1004|CDS

ATGACTGCGAGAAGTGGGAGAAGAGTAAGGGTCGTGTTTGAATTCGATGAGATGGCAACGGAGCGGGTTGGTTGGGTCAACTCTGGTGTACTCTCGATTTCTTCATCTTTCTCCAACCGAAGAGGAGTGAGGTTGACTCTGAAATCCGTTCGAATCACGCTGCCGATCATGGCAACTAGGAAAAATCTGAGCACAACCGATCACCTCCGTCATGTGGAGTCAATGTCGACTCTGCCGTCGGGTGCCGGCAAGATACCAAA...

Protein

Download Protein FASTA

746 aa · LXL04_023564|LXL04_023564|OH1004|PROTEIN

MTARSGRRVRVVFEFDEMATERVGWVNSGVLSISSSFSNRRGVRLTLKSVRITLPIMATRKNLSTTDHLRHVESMSTLPSGAGKIPKLNAVILGESLASEEDDLVFSSHDFSQKAHVPSPEKYLEMYKRSIEDPGGFWSDIASEFYWKEKWGEQVYSENLDVTKGNVKIEWFKGGITNICYNCLDKNIESGNGDKVALHWEGNEPDVDGSLTYTQLLERVCQLANFMKENGVRKGDTVIIYLPMLMELPITMLACARIGA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023564`
TK1151 ID	TkA06G274760
OH-1004 ID	LXL04_023564
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.400
Protein coverage (%)	TK1151 100.000 / OH-1004 92.493 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023564

Location Chr05:50847607-50852890 (-)

Description Similar to ACS: Acetyl-coenzyme A synthetase, chloroplastic/glyoxysomal

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g36880`	Catalyzes the production of acetyl-CoA, an activated form of acetate that can be used for lipid synthesis or for energy generation.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023564 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006068 ethanol catabolic process Biological Process

GO:0006083 acetate metabolic process Biological Process

GO:0006085 acetyl-CoA biosynthetic process Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006631 fatty acid metabolic process Biological Process

GO:0008610 lipid biosynthetic process Biological Process

GO:0019413 acetate biosynthetic process Biological Process

GO:0019427 acetyl-CoA biosynthetic process from acetate Biological Process

GO:0019542 propionate biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

aeh:Mlg_0673

ath:AT5G36880

hsa:55902

mmu:60525

rpe:RPE_0069

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.306

Rank 1 · LXL04_023564 · OH-1004

Peroxisome0.270

Rank 2 · LXL04_023564 · OH-1004

Mitochondrion0.216

Rank 3 · LXL04_023564 · OH-1004

Plastid0.189

Rank 4 · LXL04_023564 · OH-1004

Nucleus0.103

Rank 5 · LXL04_023564 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16177.12ACAS_N123-183 aa

PF00501.35AMP-binding191-568 aa

PF13193.13AMP-binding_C630-708 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023564	`PF16177.12`	ACAS_N	123	183	1.2e-18	67.3
LXL04_023564	`PF00501.35`	AMP-binding	191	568	4.8e-87	293.0
LXL04_023564	`PF13193.13`	AMP-binding_C	630	708	1.8e-24	87.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`B9DGD6`	Arabidopsis thaliana	Acetyl-coenzyme A synthetase, chloroplastic/glyoxysomal	81.042%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card