LXL04_023515 | RubberDandelionOmics

Gene overview

LXL04_023515

Reference: OH-1004 Chr: Chr05 Coordinates: 46925251-46928773 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

888 bp · LXL04_023515|LXL04_023515|OH1004|cDNA

ATGCAAGAGACACTTACCGGAGGGAAAGAGGAGACAGCCGCTGGTGACTACTTGGCGGTCGCCGGTGCACAAAAAAACCGAGAAAGGAGGTTGCCGGTGGGAGCAGGTCGTAAGAAACGAGGGGAAAAACTCACCGGTAGCCCCTTGGCTGTTAGAGCTCACGAAAGGGAGGAGAGTGGTGCTGGCAGCTCGCCGGCGGGAAGAGCACGCCAAACCTTTGCCAGAAAACAGAGAGGGAGAGGACGGACTTTCTGTTGCTT...

CDS

Download CDS FASTA

888 bp · LXL04_023515|LXL04_023515|OH1004|CDS

ATGCAAGAGACACTTACCGGAGGGAAAGAGGAGACAGCCGCTGGTGACTACTTGGCGGTCGCCGGTGCACAAAAAAACCGAGAAAGGAGGTTGCCGGTGGGAGCAGGTCGTAAGAAACGAGGGGAAAAACTCACCGGTAGCCCCTTGGCTGTTAGAGCTCACGAAAGGGAGGAGAGTGGTGCTGGCAGCTCGCCGGCGGGAAGAGCACGCCAAACCTTTGCCAGAAAACAGAGAGGGAGAGGACGGACTTTCTGTTGCTT...

Protein

Download Protein FASTA

295 aa · LXL04_023515|LXL04_023515|OH1004|PROTEIN

MQETLTGGKEETAAGDYLAVAGAQKNRERRLPVGAGRKKRGEKLTGSPLAVRAHEREESGAGSSPAGRARQTFARKQRGRGRTFCCLLDVSEKRKKEASLPVFIFGNQAGLDMLETNLVALQDITLDKMFDDACRKALFPEFDAGRKALFPEFGKIMQQGVEFQSSKTRKKMVVGFVTFENTQQGKTCGNKTLKTAEFIPRSFDKNVMPKMVTNISEYSNDVEDGDSLKDSSTLGSLVSKGRSAREVVIPLAHISYTYKT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023515`
TK1151 ID	TkA06G309350
OH-1004 ID	LXL04_023515
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	83.100
Protein coverage (%)	TK1151 100.000 / OH-1004 42.034 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023515

Location Chr05:46925251-46928773 (-)

Description Similar to ATHB-9: Homeobox-leucine zipper protein ATHB-9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g30490`	Probable transcription factor involved in the determination of adaxial-abaxial polarity in ovule primordium.	The Arabidopsis Athb-8, -9 and -14 genes are members of a small gene family coding for highly related HD-ZIP proteins.1998 · DOI: 10.1023/a:1006016319613
`At5g60690`	Probable transcription factor involved in the regulation of interfascicular fiber (cortical cells) and secondary xylem differentiation in the inflorescence stems.	IFL1, a gene regulating interfascicular fiber differentiation in Arabidopsis, encodes a homeodomain-leucine zipper protein.1999 · DOI: 10.1105/tpc.11.11.2139 Alteration of auxin polar transport in the Arabidopsis ifl1 mutants.2001 · DOI: 10.1104/pp.126.2.549 Amphivasal vascular bundle 1, a gain-of-function mutation of the IFL1/REV gene, is associated with alterations in the polarity of leaves, stems and carpels.2004 · DOI: 10.1093/pcp/pch051
`At1g52150`	Probable transcription factor involved in the regulation of meristem development to promote lateral organ formation.	Mutations in the microRNA complementarity site of the INCURVATA4 gene perturb meristem function and adaxialize lateral organs in arabidopsis.2006 · DOI: 10.1104/pp.106.077149

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0640800`	Probable transcription factor.	No verified direct reference in this release
`UniProt: A2XK30`	Probable transcription factor.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023515 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009855 determination of bilateral symmetry Biological Process

GO:0009880 embryonic pattern specification Biological Process

GO:0009943 adaxial/abaxial axis specification Biological Process

GO:0009944 polarity specification of adaxial/abaxial axis Biological Process

GO:0009956 radial pattern formation Biological Process

GO:0009965 leaf morphogenesis Biological Process

GO:0010014 meristem initiation Biological Process

GO:0010051 xylem and phloem pattern formation Biological Process

GO:0010072 primary shoot apical meristem specification Biological Process

GO:0010073 meristem maintenance Biological Process

GO:0010075 regulation of meristem growth Biological Process

KEGG gene cross-reference

ath:AT1G30490

ath:AT1G52150

ath:AT5G60690

dosa:Os03g0640800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.397

Rank 1 · LXL04_023515 · OH-1004

Nucleus0.381

Rank 2 · LXL04_023515 · OH-1004

Cell membrane0.149

Rank 3 · LXL04_023515 · OH-1004

Mitochondrion0.137

Rank 4 · LXL04_023515 · OH-1004

Endoplasmic reticulum0.081

Rank 5 · LXL04_023515 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08670.18MEKHLA99-141 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023515	`PF08670.18`	MEKHLA	99	141	1.6e-07	32.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04292`	Arabidopsis thaliana	Homeobox-leucine zipper protein ATHB-9	57.143%	Swiss-Prot	weak database homology
`Q9SE43`	Arabidopsis thaliana	Homeobox-leucine zipper protein REVOLUTA	60.000%	Swiss-Prot	weak database homology
`Q9ZU11`	Arabidopsis thaliana	Homeobox-leucine zipper protein ATHB-15	61.290%	Swiss-Prot	weak database homology
`Q6AST1`	Oryza sativa subsp. japonica	Homeobox-leucine zipper protein HOX32	50.000%	Swiss-Prot	weak database homology
`A2XK30`	Oryza sativa subsp. indica	Homeobox-leucine zipper protein HOX32	50.000%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card