LXL04_023259 | RubberDandelionOmics

Gene overview

LXL04_023259

Reference: OH-1004 Chr: Chr05 Coordinates: 29106313-29108539 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1888 bp · LXL04_023259|LXL04_023259|OH1004|cDNA

GGAATTGTGGGTACATAAAGAAAACCCCTAATTCATAGTATATCAGAACATGACCTGTCATCTCCATTCGGCATTCTCACAGTCCACATAAAACGGATTCGATCTATCAAAAGTCAAAACAGAGAAACTGCAGACACTCAAGGAACAGAGGGAGATTGCGATGGACGGAAGAAGGCCGGAGAAGGAGAAAGACATCGATGATTTACCCAAGAACGAAGCAAACTACACAGCACTAACACCACTTTGGTTTTTGAAAAGAG...

CDS

Download CDS FASTA

1761 bp · LXL04_023259|LXL04_023259|OH1004|CDS

CTGCAGACACTCAAGGAACAGAGGGAGATTGCGATGGACGGAAGAAGGCCGGAGAAGGAGAAAGACATCGATGATTTACCCAAGAACGAAGCAAACTACACAGCACTAACACCACTTTGGTTTTTGAAAAGAGCTGCTCTGGTTCACCCCCACCGCAGGTCGGTGGTGCACGGTTCCATTCAGTACACATGGGTACAAACTTACGATCGTTGCTGCCGTTTAGCCTCCGCCCTTTCGAAACACTCCGTCGGGTTTGGTTC...

Protein

Download Protein FASTA

586 aa · LXL04_023259|LXL04_023259|OH1004|PROTEIN

MQTLKEQREIAMDGRRPEKEKDIDDLPKNEANYTALTPLWFLKRAALVHPHRRSVVHGSIQYTWVQTYDRCCRLASALSKHSVGFGSTVAVIAPNIPAIYEAHFGVPMSGAVINAINIRLNAPTIAFLLQHSASTVIIVDQEYFKLAENALAILKEETQTNFNPPILIVIKDESSECDPKNLQYAEAKGVMEYEKFLESGDPEFIWKPPRDEWQSIALGYTSGTTSNPKGVVLHHRGAYLAATSNIVVWGVPEGAVYLWT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023259`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023259

Location Chr05:29106313-29108539 (-)

Description Similar to AAE7: Acetate/butyrate--CoA ligase AAE7, peroxisomal

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g16910`	Peroxisomal acetate/butyrate--CoA ligase that is probably involved in the activation of exogenous acetate for entry into the glyoxylate cycle.	Characterization of Arabidopsis fluoroacetate-resistant mutants reveals the principal mechanism of acetate activation for entry into the glyoxylate cycle.2005 · DOI: 10.1074/jbc.m407291200 Modelling the peroxisomal carbon leak during lipid mobilization in Arabidopsis.2010 · DOI: 10.1042/bst0381230 Evidence that ACN1 (acetate non-utilizing 1) prevents carbon leakage from peroxisomes during lipid mobilization in Arabidopsis seedlings.2011 · DOI: 10.1042/bj20101764
`At1g20560`	Catalyzes the ligation of CoA on butanoate to produce butanoyl-CoA.	No verified direct reference in this release
`At2g17650`	Catalyzes the ligation of CoA on isovalerate to produce 3-methylbutanoyl-CoA.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023259 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006083 acetate metabolic process Biological Process

GO:0006097 glyoxylate cycle Biological Process

GO:0006631 fatty acid metabolic process Biological Process

GO:0019605 butyrate metabolic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003987 acetate-CoA ligase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0016405 CoA-ligase activity Molecular Function

GO:0016874 ligase activity Molecular Function

KEGG gene cross-reference

ath:AT1G20560

ath:AT2G17650

ath:AT3G16910

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Peroxisome0.654

Rank 1 · LXL04_023259 · OH-1004

Mitochondrion0.166

Rank 2 · LXL04_023259 · OH-1004

Cytoplasm0.165

Rank 3 · LXL04_023259 · OH-1004

Nucleus0.054

Rank 4 · LXL04_023259 · OH-1004

Endoplasmic reticulum0.048

Rank 5 · LXL04_023259 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00501.35AMP-binding43-435 aa

PF13193.13AMP-binding_C485-565 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023259	`PF00501.35`	AMP-binding	43	435	7.7e-72	242.9
LXL04_023259	`PF13193.13`	AMP-binding_C	485	565	9.8e-20	72.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VZF1`	Arabidopsis thaliana	Acetate/butyrate--CoA ligase AAE7, peroxisomal	71.127%	Swiss-Prot	strong database homology
`F4HUK6`	Arabidopsis thaliana	Butanoate--CoA ligase AAE1	51.543%	Swiss-Prot	strong database homology
`Q9SEY5`	Arabidopsis thaliana	Isovalerate--CoA ligase AAE2	50.000%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card