LXL04_023055 | RubberDandelionOmics

Gene overview

LXL04_023055

Reference: OH-1004 Chr: Chr05 Coordinates: 21247846-21252314 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1848 bp · LXL04_023055|LXL04_023055|OH1004|cDNA

acaaatcGATGGGTAGTAGTTGTACTGAGAAAACGATTGTCTGGTTTAGAAGGGATCTGAGGATCGAAGATAATCCAGCTCTAGCTGAAGCCGCAAGAGATGGTGCTGTATTTCCTCTGTTCATATGGTGTCCTAAAGAAGAACAGCAATTTTACCCGGGTCGGGTTTCAAGATGGTGGCTGAAGCAATCGCTGATCCATTTAAGACAATCTTTGAAATCGCTTGGAGCTGATCTTGTTTTGATGAAAGCGAACAGTACT...

CDS

Download CDS FASTA

1818 bp · LXL04_023055|LXL04_023055|OH1004|CDS

ATGGGTAGTAGTTGTACTGAGAAAACGATTGTCTGGTTTAGAAGGGATCTGAGGATCGAAGATAATCCAGCTCTAGCTGAAGCCGCAAGAGATGGTGCTGTATTTCCTCTGTTCATATGGTGTCCTAAAGAAGAACAGCAATTTTACCCGGGTCGGGTTTCAAGATGGTGGCTGAAGCAATCGCTGATCCATTTAAGACAATCTTTGAAATCGCTTGGAGCTGATCTTGTTTTGATGAAAGCGAACAGTACTACTTCAGC...

Protein

Download Protein FASTA

605 aa · LXL04_023055|LXL04_023055|OH1004|PROTEIN

MGSSCTEKTIVWFRRDLRIEDNPALAEAARDGAVFPLFIWCPKEEQQFYPGRVSRWWLKQSLIHLRQSLKSLGADLVLMKANSTTSALIECITAVGATKLVYNQLYDPISLVRDHSIKQNLGELGVKVQTYNGDMLYEPWEVYDKEGYAFTTFNAYWDKCMKMQTDPSLRLPPCRLVQAPGSVDDCTIEKLGLEDESEKPSNALLGRGWSPGWINAEKALTTFIENHLLDYAKHRLKVTGNSTSILSPYIHFGELSVKKV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023055`
TK1151 ID	TkA06G409120
OH-1004 ID	LXL04_023055
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023055

Location Chr05:21247846-21252314 (+)

Description Similar to CRY2: Cryptochrome-2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g04400`	Photoreceptor that mediates primarily blue light inhibition of hypocotyl elongation and photoperiodic control of floral initiation, and regulates other light responses, including circadian rhythms, tropic growth, stomata opening, guard cell development, root development, bacterial and viral pathogen responses, abiotic stress responses, cell cycles, programmed cell death, apical dominance, fruit and ovule development, seed dormancy, and magnetoreception.	The role of cryptochrome 2 in flowering in Arabidopsis.2003 · DOI: 10.1104/pp.103.029819 Cryptochrome photoreceptors cry1 and cry2 antagonistically regulate primary root elongation in Arabidopsis thaliana.2006 · DOI: 10.1007/s00425-006-0280-6 CRYPTOCHROME2 in vascular bundles regulates flowering in Arabidopsis.2007 · DOI: 10.1105/tpc.106.048157 Double loss-of-function mutation in EARLY FLOWERING 3 and CRYPTOCHROME 2 genes delays flowering under continuous light but accelerates it under long days and short days: an important role for Arabidopsis CRY2 to accelerate flowering time in continuous light.2011 · DOI: 10.1093/jxb/erq450 Blue light-dependent interaction of CRY2 with SPA1 regulates COP1 activity and floral initiation in Arabidopsis.2011 · DOI: 10.1016/j.cub.2011.03.048 The Cryptochrome Blue Light Receptors.2010 · DOI: 10.1199/tab.0135 Phototropins but not cryptochromes mediate the blue light-specific promotion of stomatal conductance, while both enhance photosynthesis and transpiration under full sunlight.2012 · DOI: 10.1104/pp.111.187237 Lifetimes of Arabidopsis cryptochrome signaling states in vivo.2013 · DOI: 10.1111/tpj.12144 Strigolactone-regulated hypocotyl elongation is dependent on cryptochrome and phytochrome signaling pathways in Arabidopsis.2014 · DOI: 10.1093/mp/sst093 Multiple bHLH proteins form heterodimers to mediate CRY2-dependent regulation of flowering-time in Arabidopsis.2013 · DOI: 10.1371/journal.pgen.1003861 Cellular metabolites enhance the light sensitivity of Arabidopsis cryptochrome through alternate electron transfer pathways.2014 · DOI: 10.1105/tpc.114.129809 Suppression of Arabidopsis flowering by near-null magnetic field is affected by light.2015 · DOI: 10.1002/bem.21927 Blue-light dependent ROS formation by Arabidopsis cryptochrome-2 may contribute toward its signaling role.2015 · DOI: 10.1080/15592324.2015.1042647 Enhancement of blue-light sensitivity of Arabidopsis seedlings by a blue light receptor cryptochrome 2.1998 · DOI: 10.1073/pnas.95.5.2686 Cryptochrome blue-light photoreceptors of Arabidopsis implicated in phototropism.1998 · DOI: 10.1038/33701
`At4g08920`	May act as a blue-light receptor regulating hypocotyl elongation, flowering and other light responses.	Arabidopsis Mutants Lacking Blue Light-Dependent Inhibition of Hypocotyl Elongation.1991 · DOI: 10.1105/tpc.3.7.685 Cryptochrome photoreceptors cry1 and cry2 antagonistically regulate primary root elongation in Arabidopsis thaliana.2006 · DOI: 10.1007/s00425-006-0280-6 CRY1 inhibits COP1-mediated degradation of BIT1, a MYB transcription factor, to activate blue light-dependent gene expression in Arabidopsis.2008 · DOI: 10.1111/j.1365-313x.2008.03508.x CRYPTOCHROME 1 is implicated in promoting R protein-mediated plant resistance to Pseudomonas syringae in Arabidopsis.2010 · DOI: 10.1093/mp/ssp107 Arabidopsis cryptochrome-1 restrains lateral roots growth by inhibiting auxin transport.2010 · DOI: 10.1016/j.jplph.2009.12.003 Light receptor action is critical for maintaining plant biomass at warm ambient temperatures.2011 · DOI: 10.1111/j.1365-313x.2010.04434.x Cryptochrome 1 and phytochrome B control shade-avoidance responses in Arabidopsis via partially independent hormonal cascades.2011 · DOI: 10.1111/j.1365-313x.2011.04598.x Light-activated cryptochrome reacts with molecular oxygen to form a flavin-superoxide radical pair consistent with magnetoreception.2011 · DOI: 10.1074/jbc.m111.228940 Arabidopsis cryptochrome 1 interacts with SPA1 to suppress COP1 activity in response to blue light.2011 · DOI: 10.1101/gad.2025011 The Cryptochrome Blue Light Receptors.2010 · DOI: 10.1199/tab.0135 Light-induced conformational changes in full-length Arabidopsis thaliana cryptochrome.2011 · DOI: 10.1016/j.jmb.2011.08.031 Phototropins but not cryptochromes mediate the blue light-specific promotion of stomatal conductance, while both enhance photosynthesis and transpiration under full sunlight.2012 · DOI: 10.1104/pp.111.187237 The shoot regeneration capacity of excised Arabidopsis cotyledons is established during the initial hours after injury and is modulated by a complex genetic network of light signalling.2013 · DOI: 10.1111/j.1365-3040.2012.02554.x The CRYPTOCHROME1-dependent response to excess light is mediated through the transcriptional activators ZINC FINGER PROTEIN EXPRESSED IN INFLORESCENCE MERISTEM LIKE1 and ZML2 in Arabidopsis.2012 · DOI: 10.1105/tpc.112.100099 cry1 and GPA1 signaling genetically interact in hook opening and anthocyanin synthesis in Arabidopsis.2012 · DOI: 10.1007/s11103-012-9950-x Lifetimes of Arabidopsis cryptochrome signaling states in vivo.2013 · DOI: 10.1111/tpj.12144 Strigolactone-regulated hypocotyl elongation is dependent on cryptochrome and phytochrome signaling pathways in Arabidopsis.2014 · DOI: 10.1093/mp/sst093 Blue-light dependent reactive oxygen species formation by Arabidopsis cryptochrome may define a novel evolutionarily conserved signaling mechanism.2015 · DOI: 10.1111/nph.13341 Suppression of Arabidopsis flowering by near-null magnetic field is affected by light.2015 · DOI: 10.1002/bem.21927 Cellular metabolites modulate in vivo signaling of Arabidopsis cryptochrome-1.2015 · DOI: 10.1080/15592324.2015.1063758 Mutations throughout an Arabidopsis blue-light photoreceptor impair blue-light-responsive anthocyanin accumulation and inhibition of hypocotyl elongation.1995 · DOI: 10.1046/j.1365-313x.1995.08050653.x Cryptochrome blue-light photoreceptors of Arabidopsis implicated in phototropism.1998 · DOI: 10.1038/33701 Genetic interactions between phytochrome A, phytochrome B, and cryptochrome 1 during Arabidopsis development.1998 · DOI: 10.1104/pp.118.1.27

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023055 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000719 photoreactive repair Biological Process

GO:0006281 DNA repair Biological Process

GO:0006325 chromatin organization Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006952 defense response Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009266 response to temperature stimulus Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009583 detection of light stimulus Biological Process

GO:0009637 response to blue light Biological Process

GO:0009638 phototropism Biological Process

KEGG gene cross-reference

ath:AT1G04400

ath:AT4G08920

atu:Atu1218

syn:slr0854

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.463

Rank 1 · LXL04_023055 · OH-1004

Cytoplasm0.423

Rank 2 · LXL04_023055 · OH-1004

Cell membrane0.090

Rank 3 · LXL04_023055 · OH-1004

Mitochondrion0.070

Rank 4 · LXL04_023055 · OH-1004

Endoplasmic reticulum0.037

Rank 5 · LXL04_023055 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00875.25DNA_photolyase9-165 aa

PF03441.20FAD_binding_7286-482 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023055	`PF00875.25`	DNA_photolyase	9	165	2.5e-39	135.6
LXL04_023055	`PF03441.20`	FAD_binding_7	286	482	8.7e-71	238.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q96524`	Arabidopsis thaliana	Cryptochrome-2	62.842%	Swiss-Prot	strong database homology
`Q43125`	Arabidopsis thaliana	Cryptochrome-1	57.274%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card