LXL04_022916 | RubberDandelionOmics

Gene overview

LXL04_022916

Reference: OH-1004 Chr: Chr05 Coordinates: 13549641-13554135 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

675 bp · LXL04_022916|LXL04_022916|OH1004|cDNA

ATGACACCGTCATCAACAGCACCAGACACCGGCGCCACCAACACCTACAGCACAACCGCCGAAATCCGCCACGCCATCCGTCCATGGTTCGACGACTTCTTCACCTCCTTCACTCTCCCACTCTCCTTTAGCGAACTCTCCCTCCGTTTCCAGAAAAACATCTATACCTTTCGCGGCAACTACGTCATCATCTCCCTACTCATCTTCATCTTAACCCTAATTTTACGCCCAATCGCTGCAATCGTGTTCCTCTTCATCAT...

CDS

Download CDS FASTA

675 bp · LXL04_022916|LXL04_022916|OH1004|CDS

ATGACACCGTCATCAACAGCACCAGACACCGGCGCCACCAACACCTACAGCACAACCGCCGAAATCCGCCACGCCATCCGTCCATGGTTCGACGACTTCTTCACCTCCTTCACTCTCCCACTCTCCTTTAGCGAACTCTCCCTCCGTTTCCAGAAAAACATCTATACCTTTCGCGGCAACTACGTCATCATCTCCCTACTCATCTTCATCTTAACCCTAATTTTACGCCCAATCGCTGCAATCGTGTTCCTCTTCATCAT...

Protein

Download Protein FASTA

224 aa · LXL04_022916|LXL04_022916|OH1004|PROTEIN

MTPSSTAPDTGATNTYSTTAEIRHAIRPWFDDFFTSFTLPLSFSELSLRFQKNIYTFRGNYVIISLLIFILTLILRPIAAIVFLFIIVGWIYLFFARDEPLVVFDFELGGRLVLISLIVSTIVAVAVAGVWWNIFLSVVISALVVSLHAILRTPDDAESHYGALLSVVDEDGPSRGAYMQELHCHWPHSDDKVRSIHVPLYLRRFTWSGDCIYALKLENARILA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022916`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022916

Location Chr05:13549641-13554135 (+)

Description Similar to PRA1D: PRA1 family protein D

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g04260`	May be involved in both secretory and endocytic intracellular trafficking in the endosomal/prevacuolar compartments.	No verified direct reference in this release
`At1g55190`	May be involved in both secretory and endocytic intracellular trafficking in the endosomal/prevacuolar compartments.	No verified direct reference in this release
`At3g13710`	May be involved in both secretory and endocytic intracellular trafficking in the endosomal/prevacuolar compartments.	No verified direct reference in this release
`At1g08770`	May be involved in both secretory and endocytic intracellular trafficking in the endosomal/prevacuolar compartments.	No verified direct reference in this release
`At3g13720`	May be involved in both secretory and endocytic intracellular trafficking in the endosomal/prevacuolar compartments.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022916 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0016192 vesicle-mediated transport Biological Process

GO:0046739 transport of virus in multicellular host Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005774 vacuolar membrane Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0010008 endosome membrane Cellular Component

KEGG gene cross-reference

ath:AT1G04260

ath:AT1G08770

ath:AT1G55190

ath:AT3G13710

ath:AT3G13720

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.361

Rank 1 · LXL04_022916 · OH-1004

Golgi apparatus0.286

Rank 2 · LXL04_022916 · OH-1004

Lysosome / Vacuole0.191

Rank 3 · LXL04_022916 · OH-1004

Cytoplasm0.170

Rank 4 · LXL04_022916 · OH-1004

Nucleus0.123

Rank 5 · LXL04_022916 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03208.25PRA125-157 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022916	`PF03208.25`	PRA1	25	157	8.6e-35	120.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P93829`	Arabidopsis thaliana	PRA1 family protein D	37.931%	Swiss-Prot	moderate database homology
`Q9C889`	Arabidopsis thaliana	PRA1 family protein F2	37.500%	Swiss-Prot	moderate database homology
`Q9LIC7`	Arabidopsis thaliana	PRA1 family protein F4	38.060%	Swiss-Prot	moderate database homology
`Q9FRR1`	Arabidopsis thaliana	PRA1 family protein E	29.319%	Swiss-Prot	weak database homology
`Q9LIC6`	Arabidopsis thaliana	PRA1 family protein F3	38.060%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card