LXL04_022871 | RubberDandelionOmics

Gene overview

LXL04_022871

Reference: OH-1004 Chr: Chr05 Coordinates: 11247505-11250757 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3045 bp · LXL04_022871|LXL04_022871|OH1004|cDNA

ATGGCGGAAATTCTACCAATTGGTACAATCTTGGCTGTCGCAATAAACCAGGTGATCAAAACAGCTCATGCTGCAAACGACATAGTAATCGAAAAAGAAAGCTTCAAAATCCTCTCATCTCACCTCTTCGACATCCTGAATGTCCTAAAAGAACTCGAACTCCAAAAACTAAACGAATCACCAATCGCAAGAAAAGCCCTAGAAAACCTCGAAACCGACGTCCAAAAAGCCAACACACTCGtcgaaaaatacaaaaaccG...

CDS

Download CDS FASTA

3045 bp · LXL04_022871|LXL04_022871|OH1004|CDS

ATGGCGGAAATTCTACCAATTGGTACAATCTTGGCTGTCGCAATAAACCAGGTGATCAAAACAGCTCATGCTGCAAACGACATAGTAATCGAAAAAGAAAGCTTCAAAATCCTCTCATCTCACCTCTTCGACATCCTGAATGTCCTAAAAGAACTCGAACTCCAAAAACTAAACGAATCACCAATCGCAAGAAAAGCCCTAGAAAACCTCGAAACCGACGTCCAAAAAGCCAACACACTCGTCGAAAAATACAAAAACCG...

Protein

Download Protein FASTA

1014 aa · LXL04_022871|LXL04_022871|OH1004|PROTEIN

MAEILPIGTILAVAINQVIKTAHAANDIVIEKESFKILSSHLFDILNVLKELELQKLNESPIARKALENLETDVQKANTLVEKYKNRGRFYLLIKCRHIVKEVQDVTRNIGKSLNNLCLANTELLSGISDEITRLQNTMQRAEFATCHSHVQILDKLNEGLANQKLDQGFANDIIADIATAVGVVVEPSEIRKELDSFKREKEEAENRKERAEVYFLEQIIELLSRADAARDYEHSKDQYLQRLRVIEGHDPKSESIPPF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022871`
TK1151 ID	TkA06G437350
OH-1004 ID	LXL04_022871
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022871

Location Chr05:11247505-11250757 (+)

Description Similar to PUB43: U-box domain-containing protein 43

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g76390`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release
`At1g20780`	Functions as an E3 ubiquitin-protein ligase.	Identification of a novel E3 ubiquitin ligase that is required for suppression of premature senescence in Arabidopsis.2009 · DOI: 10.1111/j.1365-313x.2009.03846.x
`At1g68940`	Functions as an E3 ubiquitin ligase.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0657100`	E3 ubiquitin-protein ligase that functions as a negative regulator of brassinosteroid (BR) signaling.	OsBZR1 turnover mediated by OsSK22-regulated U-box E3 ligase OsPUB24 in rice BR response.2019 · DOI: 10.1111/tpj.14332
`Os02g0234300`	Possesses E3 ubiquitin-protein ligase in vitro.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022871 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006970 response to osmotic stress Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0010115 regulation of abscisic acid biosynthetic process Biological Process

GO:0010150 leaf senescence Biological Process

GO:0010271 regulation of chlorophyll catabolic process Biological Process

GO:0010380 regulation of chlorophyll biosynthetic process Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0090359 negative regulation of abscisic acid biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT1G20780

ath:AT1G76390

dosa:Os02g0234300

dosa:Os03g0657100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.436

Rank 1 · LXL04_022871 · OH-1004

Cell membrane0.306

Rank 2 · LXL04_022871 · OH-1004

Nucleus0.304

Rank 3 · LXL04_022871 · OH-1004

Endoplasmic reticulum0.075

Rank 4 · LXL04_022871 · OH-1004

Golgi apparatus0.058

Rank 5 · LXL04_022871 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19584.4MCAfunc22-121 aa

PF04564.22U-box262-327 aa

PF24768.2ARM_ARMC5563-754 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022871	`PF19584.4`	MCAfunc	22	121	2e-06	28.2
LXL04_022871	`PF04564.22`	U-box	262	327	5.9e-13	49.5
LXL04_022871	`PF24768.2`	ARM_ARMC5	563	754	4.9e-14	53.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SFX2`	Arabidopsis thaliana	U-box domain-containing protein 43	26.562%	Swiss-Prot	weak database homology
`Q9LM76`	Arabidopsis thaliana	U-box domain-containing protein 44	26.170%	Swiss-Prot	weak database homology
`Q9CAA7`	Arabidopsis thaliana	Putative U-box domain-containing protein 42	24.934%	Swiss-Prot	weak database homology
`Q10FT0`	Oryza sativa subsp. japonica	U-box domain-containing protein 24	25.540%	Swiss-Prot	weak database homology
`Q6EUK7`	Oryza sativa subsp. japonica	U-box domain-containing protein 4	25.940%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card