LXL04_022786 | RubberDandelionOmics

Gene overview

LXL04_022786

Reference: OH-1004 Chr: Chr05 Coordinates: 9252586-9254940 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1017 bp · LXL04_022786|LXL04_022786|OH1004|cDNA

ATGGGCGAGAAGGATGATGGTCTGGGGTTGAGTTTGGGTTTGAAATGCTCGGAAGATTATCCACCCCCGCCGCTGCCGCTGCCGGTTGTTGCCGGTTCGAACGCTGCGACGCGTTTTCCGTTGAATCTGTTGACATCTCCCCCTTTGTCATTTGTTCAACGGCATCATGTTCCGAATCATCAAAAGCTTTCGTTCATGATCAATCACGCTGCGCCTCCTCCCTCCGTTCCTCCGCCTGATTTAAATGCCGAAACCAGATC...

CDS

Download CDS FASTA

1017 bp · LXL04_022786|LXL04_022786|OH1004|CDS

ATGGGCGAGAAGGATGATGGTCTGGGGTTGAGTTTGGGTTTGAAATGCTCGGAAGATTATCCACCCCCGCCGCTGCCGCTGCCGGTTGTTGCCGGTTCGAACGCTGCGACGCGTTTTCCGTTGAATCTGTTGACATCTCCCCCTTTGTCATTTGTTCAACGGCATCATGTTCCGAATCATCAAAAGCTTTCGTTCATGATCAATCACGCTGCGCCTCCTCCCTCCGTTCCTCCGCCTGATTTAAATGCCGAAACCAGATC...

Protein

Download Protein FASTA

338 aa · LXL04_022786|LXL04_022786|OH1004|PROTEIN

MGEKDDGLGLSLGLKCSEDYPPPPLPLPVVAGSNAATRFPLNLLTSPPLSFVQRHHVPNHQKLSFMINHAAPPPSVPPPDLNAETRSYSRGIDVNRLPSTSAVAPLTTERDDEALVSSPNSTLSSVSGKRVEREENEAERESSSHGISGDEDDEGGEASAARKKLRLSKDQAAVLEETFKEHNTLNPKQKLALAKQLDLRPRQVEVWFQNRRARTKLKQTEVDCEYLKRCCDTLTDENRRLQKEVNELRALKLSPQFYMN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022786`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022786

Location Chr05:9252586-9254940 (+)

Description Similar to HAT3: Homeobox-leucine zipper protein HAT3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g60390`	Probable transcription factor.	No verified direct reference in this release
`At2g44910`	Probable transcription factor.	No verified direct reference in this release
`At4g16780`	Probable transcription factor involved in the negative regulation of cell elongation and specific cell proliferation processes such as lateral root formation and secondary growth of the vascular system.	Negative autoregulation of the Arabidopsis homeobox gene ATHB-2.2001 · DOI: 10.1046/j.1365-313x.2001.00966.x The HAT4 gene of Arabidopsis encodes a developmental regulator.1993 · DOI: 10.1101/gad.7.3.367
`At4g17460`	Probable transcription factor.	No verified direct reference in this release
`At5g47370`	Probable transcription factor that plays a role in auxin-mediated morphogenesis.	The HAT2 gene, a member of the HD-Zip gene family, isolated as an auxin inducible gene by DNA microarray screening, affects auxin response in Arabidopsis.2002 · DOI: 10.1046/j.1365-313x.2002.01488.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022786 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0003006 developmental process involved in reproduction Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009585 red, far-red light phototransduction Biological Process

GO:0009641 shade avoidance Biological Process

GO:0009725 response to hormone Biological Process

GO:0009733 response to auxin Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0009735 response to cytokinin Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0010016 shoot system morphogenesis Biological Process

GO:0010017 red or far-red light signaling pathway Biological Process

KEGG gene cross-reference

ath:AT2G44910

ath:AT3G60390

ath:AT4G16780

ath:AT4G17460

ath:AT5G47370

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.984

Rank 1 · LXL04_022786 · OH-1004

Cytoplasm0.066

Rank 2 · LXL04_022786 · OH-1004

Cell membrane0.022

Rank 3 · LXL04_022786 · OH-1004

Endoplasmic reticulum0.014

Rank 4 · LXL04_022786 · OH-1004

Plastid0.009

Rank 5 · LXL04_022786 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04618.18HD-ZIP_N1-134 aa

PF00046.36Homeodomain162-216 aa

PF02183.24HALZ218-252 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022786	`PF04618.18`	HD-ZIP_N	1	134	4.2e-22	79.4
LXL04_022786	`PF00046.36`	Homeodomain	162	216	1.1e-15	57.8
LXL04_022786	`PF02183.24`	HALZ	218	252	2.5e-11	44.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P46602`	Arabidopsis thaliana	Homeobox-leucine zipper protein HAT3	68.571%	Swiss-Prot	moderate database homology
`P92953`	Arabidopsis thaliana	Homeobox-leucine zipper protein ATHB-4	55.892%	Swiss-Prot	strong database homology
`Q05466`	Arabidopsis thaliana	Homeobox-leucine zipper protein HAT4	57.092%	Swiss-Prot	strong database homology
`P46600`	Arabidopsis thaliana	Homeobox-leucine zipper protein HAT1	53.378%	Swiss-Prot	strong database homology
`P46601`	Arabidopsis thaliana	Homeobox-leucine zipper protein HAT2	52.013%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card