LXL04_022670 | RubberDandelionOmics

Gene overview

LXL04_022670

Reference: OH-1004 Chr: Chr05 Coordinates: 4503002-4504996 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

720 bp · LXL04_022670|LXL04_022670|OH1004|cDNA

TGGCCTTTACACCCTAATTTCAGTTTGCGCTCCACCCCCAAAATCAACGACACCACCAGCAATTTTCTTTTGATCGTCAATCTCCACCCAGCGTTTTTGTGCGAAAGATCGAGAGAGATGGTGACTTCATCTGTCGTAAACACATACCCTCTTTCGAGCTACTCCTTCGGCACTAAAGAACCCAAAATGGAGAAAGACACTTCTGTTGCTGATCGTCTTGCTCGCATGAAACTAAACTATATGAAGGAAGGTATGAGGAC...

CDS

Download CDS FASTA

696 bp · LXL04_022670|LXL04_022670|OH1004|CDS

TTGCGCTCCACCCCCAAAATCAACGACACCACCAGCAATTTTCTTTTGATCGTCAATCTCCACCCAGCGTTTTTGTGCGAAAGATCGAGAGAGATGGTGACTTCATCTGTCGTAAACACATACCCTCTTTCGAGCTACTCCTTCGGCACTAAAGAACCCAAAATGGAGAAAGACACTTCTGTTGCTGATCGTCTTGCTCGCATGAAACTAAACTATATGAAGGAAGGTATGAGGACCAGTGTTGAAGCAATCTTACTGGT...

Protein

Download Protein FASTA

231 aa · LXL04_022670|LXL04_022670|OH1004|PROTEIN

MRSTPKINDTTSNFLLIVNLHPAFLCERSREMVTSSVVNTYPLSSYSFGTKEPKMEKDTSVADRLARMKLNYMKEGMRTSVEAILLVQEHNHPHILLLQIGNTFCKLPGGRLKPGENEVEGLKRKLSSKLAANSPNMQPNWQIGECVAVWWRPNFETIMYPYCPPHISKPKECKKLYVVHLSEREYFAVPKNLKLLAVPLFELYDNVQRYGPVISTIPQQLSRFQFNMIPA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022670`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022670

Location Chr05:4503002-4504996 (+)

Description Similar to CFIS2: Pre-mRNA cleavage factor Im 25 kDa subunit 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g25550`	Component of the cleavage factor Im (CFIm) complex that plays a key role in pre-mRNA 3'-processing.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022670 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006364 rRNA processing Biological Process

GO:0006397 mRNA processing Biological Process

GO:0010608 post-transcriptional regulation of gene expression Biological Process

GO:0030154 cell differentiation Biological Process

GO:0031124 mRNA 3'-end processing Biological Process

GO:0051262 protein tetramerization Biological Process

GO:0051290 protein heterotetramerization Biological Process

GO:0110104 mRNA alternative polyadenylation Biological Process

GO:0180010 co-transcriptional mRNA 3'-end processing, cleavage and polyadenylation pathway Biological Process

GO:2000738 positive regulation of stem cell differentiation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

KEGG gene cross-reference

ath:AT4G25550

dre:394092

hsa:11051

pon:100172645

xla:444830

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.405

Rank 1 · LXL04_022670 · OH-1004

Cytoplasm0.343

Rank 2 · LXL04_022670 · OH-1004

Mitochondrion0.178

Rank 3 · LXL04_022670 · OH-1004

Cell membrane0.074

Rank 4 · LXL04_022670 · OH-1004

Endoplasmic reticulum0.068

Rank 5 · LXL04_022670 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13869.13NUDIX_237-224 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022670	`PF13869.13`	NUDIX_2	37	224	1.1e-85	286.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GXS3`	Arabidopsis thaliana	Pre-mRNA cleavage factor Im 25 kDa subunit 2	86.869%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card