LXL04_022481 | RubberDandelionOmics

Gene overview

LXL04_022481

Reference: OH-1004 Chr: Chr04 Coordinates: 151209781-151211613 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

750 bp · LXL04_022481|LXL04_022481|OH1004|cDNA

ATGGACTACACCTTTCCTAGGGAGACGTTATGGAGGACAGCCTCAAGAATCACCATATCAGCGCACCTGTTTGGTATTTTAGCAAACATCCTTATGCTTATTTGGTTGTTGCACTATCGTCAAGGCATCGACCTTGATTCATCCAACCCATATCGTATATTCAATGTCCACCCTTTCCTTATGTTCTTCGGATTCATATTCCTCATTGGCGAAGCGATGATGGCATATAAGACGGTACCGGGAGATAGGCCAACACAAAA...

CDS

Download CDS FASTA

750 bp · LXL04_022481|LXL04_022481|OH1004|CDS

ATGGACTACACCTTTCCTAGGGAGACGTTATGGAGGACAGCCTCAAGAATCACCATATCAGCGCACCTGTTTGGTATTTTAGCAAACATCCTTATGCTTATTTGGTTGTTGCACTATCGTCAAGGCATCGACCTTGATTCATCCAACCCATATCGTATATTCAATGTCCACCCTTTCCTTATGTTCTTCGGATTCATATTCCTCATTGGCGAAGCGATGATGGCATATAAGACGGTACCGGGAGATAGGCCAACACAAAA...

Protein

Download Protein FASTA

249 aa · LXL04_022481|LXL04_022481|OH1004|PROTEIN

MDYTFPRETLWRTASRITISAHLFGILANILMLIWLLHYRQGIDLDSSNPYRIFNVHPFLMFFGFIFLIGEAMMAYKTVPGDRPTQKFVHMFLNLSALVLGIVGIHATFKFHDKMNMLDMYSLHSWIGIGTFCLFILQWLFGFSLFVFPKASAVTRARLAPWHVFMGRALLYMAICAAETGLMQKFTFLQLTNNRESYLINFLALTILLFGITVDISSYFVGSSDNPNYVLVSTVFNGNNFNEGKCSMI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022481`
TK1151 ID	TkA05G471060
OH-1004 ID	LXL04_022481
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	100.000
Protein coverage (%)	TK1151 96.373 / OH-1004 74.699 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022481

Location Chr04:151209781-151211613 (+)

Description Similar to CYB561C: Probable transmembrane ascorbate ferrireductase 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g14730`	Two-heme-containing cytochrome.	No verified direct reference in this release
`At4g25570`	Two-heme-containing cytochrome.	Localization of an ascorbate-reducible cytochrome b561 in the plant tonoplast.2004 · DOI: 10.1104/pp.103.032359
`At5g38630`	Two-heme-containing cytochrome.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0642300`	Two-heme-containing cytochrome.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022481 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0019852 L-ascorbic acid metabolic process Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009705 plant-type vacuole membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0000293 ferric-chelate reductase activity Molecular Function

GO:0009055 electron transfer activity Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

KEGG gene cross-reference

ath:AT1G14730

ath:AT4G25570

ath:AT5G38630

dosa:Os02g0642300

zma:100273009

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.356

Rank 1 · LXL04_022481 · OH-1004

Lysosome / Vacuole0.281

Rank 2 · LXL04_022481 · OH-1004

Cytoplasm0.275

Rank 3 · LXL04_022481 · OH-1004

Golgi apparatus0.142

Rank 4 · LXL04_022481 · OH-1004

Endoplasmic reticulum0.126

Rank 5 · LXL04_022481 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03188.22Cytochrom_B56156-188 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022481	`PF03188.22`	Cytochrom_B561	56	188	4.7e-42	144.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q67ZF6`	Arabidopsis thaliana	Probable transmembrane ascorbate ferrireductase 3	59.447%	Swiss-Prot	strong database homology
`Q8L856`	Arabidopsis thaliana	Transmembrane ascorbate ferrireductase 1	40.000%	Swiss-Prot	moderate database homology
`Q9SWS1`	Arabidopsis thaliana	Transmembrane ascorbate ferrireductase 2	41.026%	Swiss-Prot	moderate database homology
`A3A9H6`	Oryza sativa subsp. japonica	Probable ascorbate-specific transmembrane electron transporter 1	41.872%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card