Gene Card
Gene overview
cDNA / CDS / Protein Sequences
543 bp · LXL04_022390|LXL04_022390|OH1004|cDNA
ATGGGATGGATCGGGGAGCAGATCGATGCGGTGAAATCTATGCAGTTCAGACAGCTACTCACTCAAGCCGTTAGCCTTGGTATGATTGTTACATCAGCATTAATCATATGGAAAGGGCTGATGTGCATAACTGGTAGTGAATCACCTGTTGTTGTTGTGCTTTCTGGAAGTATGGAACCTGGCTTCAAAAGAGGTGATATTCTGTTTCTACATATGAGTAAGGAACCAATTCGAGCTGGGGAAATCGTGGTGTTCAATGT...
543 bp · LXL04_022390|LXL04_022390|OH1004|CDS
ATGGGATGGATCGGGGAGCAGATCGATGCGGTGAAATCTATGCAGTTCAGACAGCTACTCACTCAAGCCGTTAGCCTTGGTATGATTGTTACATCAGCATTAATCATATGGAAAGGGCTGATGTGCATAACTGGTAGTGAATCACCTGTTGTTGTTGTGCTTTCTGGAAGTATGGAACCTGGCTTCAAAAGAGGTGATATTCTGTTTCTACATATGAGTAAGGAACCAATTCGAGCTGGGGAAATCGTGGTGTTCAATGT...
Protein
Download Protein FASTA180 aa · LXL04_022390|LXL04_022390|OH1004|PROTEIN
MGWIGEQIDAVKSMQFRQLLTQAVSLGMIVTSALIIWKGLMCITGSESPVVVVLSGSMEPGFKRGDILFLHMSKEPIRAGEIVVFNVDGREIPIVHRVIKVHEREDSGEVDVLTKGDNNFGDDRLLYAEGQMWLQRHHIMGRAVGFLPYVGWVTIIMTEQPIIKYILIGALGLLVITSKE
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_022390 |
|---|---|
| TK1151 ID | TkA05G464260 |
| OH-1004 ID | LXL04_022390 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_022390 |
|---|---|
| Location | Chr04:149487329-149489108 (+) |
| Description | Similar to SEC11C: Signal peptidase complex catalytic subunit SEC11C |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006465 signal peptide processing Biological Process GO:0005787 signal peptidase complex Cellular Component GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0004252 serine-type endopeptidase activity Molecular Function GO:0008233 peptidase activity Molecular Function GO:0009003 signal peptidase activity Molecular Function |
| KEGG gene cross-reference | cfa:404003 hsa:90701 mmu:66286 pon:100174381 rno:266758 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00717.29Peptidase_S2438-103 aaPF31032.1SPase_CTS152-177 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_022390 | PF00717.29 | Peptidase_S24 | 38 | 103 | 4.2e-09 | 36.8 |
| LXL04_022390 | PF31032.1 | SPase_CTS | 152 | 177 | 1.1e-09 | 38.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.