LXL04_022300 | RubberDandelionOmics

Gene overview

LXL04_022300

Reference: OH-1004 Chr: Chr04 Coordinates: 147852775-147854728 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1236 bp · LXL04_022300|LXL04_022300|OH1004|cDNA

ATGGAGGTTCATGAAGATGAAGATATAGTGATAATCGGTGCTGGGATAGCTGGTCTCACTACCGCCTTAGCTCTTCACAGATTGGGTTTGAAGAGCTTGGTGTTGGAGTCATCAGAGAGCTTGCGAATTACCGGATTCGCCCTTACACTATGGACCAATGCTTGGAAGGCACTAGACGCCGTTGGAATCGGGGATTCCCTCCGACAAAAGTCCACCCAAATGAAAGGATTCAAGATCGCCTCTCCCGATACTGGTCTTTT...

CDS

Download CDS FASTA

1236 bp · LXL04_022300|LXL04_022300|OH1004|CDS

ATGGAGGTTCATGAAGATGAAGATATAGTGATAATCGGTGCTGGGATAGCTGGTCTCACTACCGCCTTAGCTCTTCACAGATTGGGTTTGAAGAGCTTGGTGTTGGAGTCATCAGAGAGCTTGCGAATTACCGGATTCGCCCTTACACTATGGACCAATGCTTGGAAGGCACTAGACGCCGTTGGAATCGGGGATTCCCTCCGACAAAAGTCCACCCAAATGAAAGGATTCAAGATCGCCTCTCCCGATACTGGTCTTTT...

Protein

Download Protein FASTA

411 aa · LXL04_022300|LXL04_022300|OH1004|PROTEIN

MEVHEDEDIVIIGAGIAGLTTALALHRLGLKSLVLESSESLRITGFALTLWTNAWKALDAVGIGDSLRQKSTQMKGFKIASPDTGLFTSQQALDKDGKFKGYESRCVRRKDLMDTLVSELPPDTIRYSCKVVAIDEHHRFKLVHLANGSILKTKVLIGCDGVNSVVAKWLGLGSPVSVGRSAIRGLVEFPNGSGFDPMFHVNFGNGVRYGFLPVDDKTVYWFCTFTPSQVPSYEDDWQENPIKLKQFVLSRINNMSQEAQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022300`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022300

Location Chr04:147852775-147854728 (+)

Description Similar to MO2: Monooxygenase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g38540`	Monooxygenase 2.	No verified direct reference in this release
`At5g05320`	Monooxygenase 3.	No verified direct reference in this release
`At4g15760`	Monooxygenase 1.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022300 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002239 response to oomycetes Biological Process

GO:0006144 purine nucleobase metabolic process Biological Process

GO:0009620 response to fungus Biological Process

GO:0019628 urate catabolic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004497 monooxygenase activity Molecular Function

GO:0004846 urate oxidase activity Molecular Function

GO:0016709 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen Molecular Function

GO:0070402 NADPH binding Molecular Function

KEGG gene cross-reference

aci:ACIAD3540

ath:AT4G15760

ath:AT4G38540

ath:AT5G05320

mva:Mvan_5278

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.318

Rank 1 · LXL04_022300 · OH-1004

Cytoplasm0.220

Rank 2 · LXL04_022300 · OH-1004

Lysosome / Vacuole0.155

Rank 3 · LXL04_022300 · OH-1004

Peroxisome0.111

Rank 4 · LXL04_022300 · OH-1004

Nucleus0.094

Rank 5 · LXL04_022300 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01494.26FAD_binding_38-328 aa

PF01266.31DAO8-39 aa

PF00890.31FAD_binding_28-72 aa

PF05834.19Lycopene_cycl8-165 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022300	`PF01494.26`	FAD_binding_3	8	328	2.9e-20	73.5
LXL04_022300	`PF01266.31`	DAO	8	39	2.4e-07	31.3
LXL04_022300	`PF00890.31`	FAD_binding_2	8	72	3.3e-07	30.6
LXL04_022300	`PF05834.19`	Lycopene_cycl	8	165	7.8e-07	29.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81816`	Arabidopsis thaliana	Monooxygenase 2	50.242%	Swiss-Prot	strong database homology
`Q9FLC2`	Arabidopsis thaliana	Monooxygenase 3	48.058%	Swiss-Prot	moderate database homology
`O81815`	Arabidopsis thaliana	Monooxygenase 1	33.985%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card