LXL04_022293 | RubberDandelionOmics

Gene overview

LXL04_022293

Reference: OH-1004 Chr: Chr04 Coordinates: 147710617-147714388 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1575 bp · LXL04_022293|LXL04_022293|OH1004|cDNA

ATGGGTATTTGTTGGTCTTTCCTAAAGCCTCATCGAAGCCAAGATATCCCGATTTCATCACCTTCACCCCCTCACCACCATCTTCCTGATCAAGAAAGAACATACTATCCGATCCCCAGCATGTTCGACCCAAAGAAAACCATCAAGAACCATGAAAACGGATCCATTCTAGGAAAGGAGTACGTCGATCTAAATAAAGTTTACCATATCGGGAAAGAATTAGGGAGAGGACAGTTTGGTATCACGTATCTTTGCACTGA...

CDS

Download CDS FASTA

1575 bp · LXL04_022293|LXL04_022293|OH1004|CDS

ATGGGTATTTGTTGGTCTTTCCTAAAGCCTCATCGAAGCCAAGATATCCCGATTTCATCACCTTCACCCCCTCACCACCATCTTCCTGATCAAGAAAGAACATACTATCCGATCCCCAGCATGTTCGACCCAAAGAAAACCATCAAGAACCATGAAAACGGATCCATTCTAGGAAAGGAGTACGTCGATCTAAATAAAGTTTACCATATCGGGAAAGAATTAGGGAGAGGACAGTTTGGTATCACGTATCTTTGCACTGA...

Protein

Download Protein FASTA

524 aa · LXL04_022293|LXL04_022293|OH1004|PROTEIN

MGICWSFLKPHRSQDIPISSPSPPHHHLPDQERTYYPIPSMFDPKKTIKNHENGSILGKEYVDLNKVYHIGKELGRGQFGITYLCTEKSSGLKYACKSISKRKLVTKKDMDDVRREIMMLQHLTGQPNIVEFRGAYEDESSVHLVMELCNGGELFDRITKKGSYSEKEAAKIGRQIVNVVHVCHFMGVMHRDLKPENFLMVSQDEASPLKATDFGLSVFIEEGIIYKEIVGSAYYVAPEVLCRHYGKETDVWSAGVILYI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022293`
TK1151 ID	TkA05G457060
OH-1004 ID	LXL04_022293
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022293

Location Chr04:147710617-147714388 (-)

Description Similar to CPK29: Calcium-dependent protein kinase 29

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g76040`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`At3g20410`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`At1g50700`	Ca(2+)-dependent protein kinase.	THI1, a Thiamine Thiazole Synthase, Interacts with Ca2+-Dependent Protein Kinase CPK33 and Modulates the S-Type Anion Channels and Stomatal Closure in Arabidopsis.2016 · DOI: 10.1104/pp.15.01649

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0515100`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022293 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0004683 calcium/calmodulin-dependent protein kinase activity Molecular Function

GO:0005509 calcium ion binding Molecular Function

GO:0005516 calmodulin binding Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G50700

ath:AT1G76040

ath:AT3G20410

dosa:Os07g0515100

osa:4343373

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.517

Rank 1 · LXL04_022293 · OH-1004

Cytoplasm0.355

Rank 2 · LXL04_022293 · OH-1004

Nucleus0.198

Rank 3 · LXL04_022293 · OH-1004

Golgi apparatus0.082

Rank 4 · LXL04_022293 · OH-1004

Endoplasmic reticulum0.073

Rank 5 · LXL04_022293 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase68-326 aa

PF07714.24PK_Tyr_Ser-Thr69-319 aa

PF21008.4AIF-1351-435 aa

PF12763.14EH369-434 aa

PF13499.13EF-hand_7374-435 aa

PF00036.39EF-hand_1375-402 aa

PF13405.13EF-hand_6375-403 aa

PF13202.13EF-hand_5375-397 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022293	`PF00069.32`	Pkinase	68	326	7.8e-78	262.2
LXL04_022293	`PF07714.24`	PK_Tyr_Ser-Thr	69	319	4.4e-28	99.0
LXL04_022293	`PF21008.4`	AIF-1	351	435	6.1e-07	30.5
LXL04_022293	`PF12763.14`	EH	369	434	2.8e-10	40.7
LXL04_022293	`PF13499.13`	EF-hand_7	374	435	3e-32	111.5
LXL04_022293	`PF00036.39`	EF-hand_1	375	402	3.1e-34	114.7
LXL04_022293	`PF13405.13`	EF-hand_6	375	403	2.7e-27	92.5
LXL04_022293	`PF13202.13`	EF-hand_5	375	397	9.3e-26	88.8
LXL04_022293	`PF13833.13`	EF-hand_8	387	434	7.7e-16	58.3
LXL04_022293	`PF00036.39`	EF-hand_1	410	435	3.1e-34	114.7
LXL04_022293	`PF13499.13`	EF-hand_7	444	507	3e-32	111.5
LXL04_022293	`PF13405.13`	EF-hand_6	447	475	2.7e-27	92.5
LXL04_022293	`PF00036.39`	EF-hand_1	448	472	3.1e-34	114.7
LXL04_022293	`PF13202.13`	EF-hand_5	448	469	9.3e-26	88.8
LXL04_022293	`PF13833.13`	EF-hand_8	459	508	7.7e-16	58.3
LXL04_022293	`PF00036.39`	EF-hand_1	482	508	3.1e-34	114.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RWL2`	Arabidopsis thaliana	Calcium-dependent protein kinase 29	75.870%	Swiss-Prot	strong database homology
`Q38868`	Arabidopsis thaliana	Calcium-dependent protein kinase 9	63.993%	Swiss-Prot	strong database homology
`Q9C6P3`	Arabidopsis thaliana	Calcium-dependent protein kinase 33	65.184%	Swiss-Prot	strong database homology
`P53683`	Oryza sativa subsp. japonica	Calcium-dependent protein kinase 19	71.616%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card