Gene Card
Gene overview
cDNA / CDS / Protein Sequences
444 bp · LXL04_022154|LXL04_022154|OH1004|cDNA
ATGATCTATTGTTTTCATACTTCTTTTGTATCATCACTCAACATACGTCGTGAATTCAAAATTGTATCCCTTTATATCTCTACCATTCGCTGTGTTGTGGTCTGTAGTGAGAGTATGAGGTGTTCATCTCCAGTCCTTATGAGAACAATGGTGGAAAGCAAAACAAGCAAAAACGTGCTTCGATTGTTTTATCTATTAGGGTATAAATTAGACCATGAACTTTTAAGAGTAGGATTTGCTTTCCATTTTCAAAGAGGTGT...
444 bp · LXL04_022154|LXL04_022154|OH1004|CDS
ATGATCTATTGTTTTCATACTTCTTTTGTATCATCACTCAACATACGTCGTGAATTCAAAATTGTATCCCTTTATATCTCTACCATTCGCTGTGTTGTGGTCTGTAGTGAGAGTATGAGGTGTTCATCTCCAGTCCTTATGAGAACAATGGTGGAAAGCAAAACAAGCAAAAACGTGCTTCGATTGTTTTATCTATTAGGGTATAAATTAGACCATGAACTTTTAAGAGTAGGATTTGCTTTCCATTTTCAAAGAGGTGT...
Protein
Download Protein FASTA147 aa · LXL04_022154|LXL04_022154|OH1004|PROTEIN
MIYCFHTSFVSSLNIRREFKIVSLYISTIRCVVVCSESMRCSSPVLMRTMVESKTSKNVLRLFYLLGYKLDHELLRVGFAFHFQRGVQIAVTVSYVNKMLKLHATDEAIPVTPSIQLVEVTAPASAENYTDVAAAISSITQILLKIL
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_022154 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_022154 | ||||||
|---|---|---|---|---|---|---|---|
| Location | Chr04:145422749-145423263 (-) | ||||||
| Description | Similar to MED18: Mediator of RNA polymerase II transcription subunit 18 | ||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | ||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||
| GO annotations (OH1004 source) | GO:0006353 DNA-templated transcription termination Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0006952 defense response Biological Process GO:0009723 response to ethylene Biological Process GO:0009737 response to abscisic acid Biological Process GO:0009738 abscisic acid-activated signaling pathway Biological Process GO:0009873 ethylene-activated signaling pathway Biological Process GO:0010219 regulation of vernalization response Biological Process GO:0031554 regulation of termination of DNA-templated transcription Biological Process GO:0032784 regulation of DNA-templated transcription elongation Biological Process GO:0035196 miRNA processing Biological Process GO:0045892 negative regulation of DNA-templated transcription Biological Process | ||||||
| KEGG gene cross-reference | ath:AT2G22370 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
No result was found for this query.
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
| Protein | Organism | Description | Identity | Database | Confidence |
|---|---|---|---|---|---|
Q9SJZ6 | Arabidopsis thaliana | Mediator of RNA polymerase II transcription subunit 18 | 66.019% | Swiss-Prot | strong database homology |