LXL04_021858 | RubberDandelionOmics

Gene overview

LXL04_021858

Reference: OH-1004 Chr: Chr04 Coordinates: 138753679-138755044 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

693 bp · LXL04_021858|LXL04_021858|OH1004|cDNA

ATGCCTGCCAGAACCAAAATCCCTCCCCTCGCCATACTATGGGGTTTACTTCTCTTCGGAACCGTAGTTTTTGTTCTGAACCGAATTACAGATAGTGATATTGTTTCAGAACATAAAGCTCTAAACAATCAGCTCAATCGTATGGCAGGTGGACCAGAAGGAGATCTAGACGAAGTTACACACAAGGTTTATTTTGATGTTGAGATTGGGGGAAAACCGTCGGGTCGCATAATCATAGGCCTCTTCGGGAACACAGTACC...

CDS

Download CDS FASTA

693 bp · LXL04_021858|LXL04_021858|OH1004|CDS

ATGCCTGCCAGAACCAAAATCCCTCCCCTCGCCATACTATGGGGTTTACTTCTCTTCGGAACCGTAGTTTTTGTTCTGAACCGAATTACAGATAGTGATATTGTTTCAGAACATAAAGCTCTAAACAATCAGCTCAATCGTATGGCAGGTGGACCAGAAGGAGATCTAGACGAAGTTACACACAAGGTTTATTTTGATGTTGAGATTGGGGGAAAACCGTCGGGTCGCATAATCATAGGCCTCTTCGGGAACACAGTACC...

Protein

Download Protein FASTA

230 aa · LXL04_021858|LXL04_021858|OH1004|PROTEIN

MPARTKIPPLAILWGLLLFGTVVFVLNRITDSDIVSEHKALNNQLNRMAGGPEGDLDEVTHKVYFDVEIGGKPSGRIIIGLFGNTVPKTAENFRALCTGEKGIGKNGKPLHYKGSTFHRIIPSFMIQGGDFTRGDGRGGESIYGEKFPDENFKLKHTDPGVLSMANAGPDTNGSQFFITTVITSWLDGRHVVFGKVVSGMDVVHKIEAEGRQNGTPKSNVVVVDSGELHL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021858`
TK1151 ID	TkA05G430500
OH-1004 ID	LXL04_021858
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.100
Protein coverage (%)	TK1151 98.165 / OH-1004 92.609 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021858

Location Chr04:138753679-138755044 (+)

Description Similar to CYP19-4: Peptidyl-prolyl cis-trans isomerase CYP19-4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g55920`	PPIases accelerate the folding of proteins.	No verified direct reference in this release
`At2g29960`	PPIases accelerate the folding of proteins.	A conserved domain of the arabidopsis GNOM protein mediates subunit interaction and cyclophilin 5 binding.2000 · DOI: 10.1105/tpc.12.3.343
`At5g58710`	PPIases accelerate the folding of proteins.	Mutations in a new Arabidopsis cyclophilin disrupt its interaction with protein phosphatase 2A.1999 · DOI: 10.1007/s004380051147

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021858 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006457 protein folding Biological Process

GO:0048364 root development Biological Process

GO:0061083 regulation of protein refolding Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005768 endosome Cellular Component

GO:0005771 multivesicular body Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005795 Golgi stack Cellular Component

GO:0005797 Golgi medial cisterna Cellular Component

KEGG gene cross-reference

ath:AT2G29960

ath:AT3G55920

ath:AT5G58710

cel:CELE_Y75B12B.2

ddi:DDB_G0269120

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.417

Rank 1 · LXL04_021858 · OH-1004

Golgi apparatus0.370

Rank 2 · LXL04_021858 · OH-1004

Cytoplasm0.090

Rank 3 · LXL04_021858 · OH-1004

Extracellular0.063

Rank 4 · LXL04_021858 · OH-1004

Lysosome / Vacuole0.059

Rank 5 · LXL04_021858 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00160.27Pro_isomerase64-224 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021858	`PF00160.27`	Pro_isomerase	64	224	6.7e-50	170.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L8W5`	Arabidopsis thaliana	Peptidyl-prolyl cis-trans isomerase CYP21-2	66.079%	Swiss-Prot	strong database homology
`Q8LDP4`	Arabidopsis thaliana	Peptidyl-prolyl cis-trans isomerase CYP19-4	84.091%	Swiss-Prot	strong database homology
`Q9SP02`	Arabidopsis thaliana	Peptidyl-prolyl cis-trans isomerase CYP20-1	83.523%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card