LXL04_021827 | RubberDandelionOmics

Gene overview

LXL04_021827

Reference: OH-1004 Chr: Chr04 Coordinates: 137739145-137755534 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

7509 bp · LXL04_021827|LXL04_021827|OH1004|cDNA

ATGGAGGCGACCGCCTGTTTCCTCAACCTCCGGCGACCTTGCAGTGACCTCCGGCGAGAGGACCCCAGCAGCAGCCGTATCGCCCTCTTCCTCGATCTCCGGCGACTCTCCGGCATGTTGCAGCGTCGTCGATGTGCAGGTCCTCCTCTGGAAATGCTCGGTGTTGCCAGGCGCTCTATCCCTCGCTCCGCTGCTCTCACCATTCGTTCTCTATATCTGAAACGACCAACGACGGGCATTTTGTGCCTTCGTGCGGCTGA...

CDS

Download CDS FASTA

7509 bp · LXL04_021827|LXL04_021827|OH1004|CDS

ATGGAGGCGACCGCCTGTTTCCTCAACCTCCGGCGACCTTGCAGTGACCTCCGGCGAGAGGACCCCAGCAGCAGCCGTATCGCCCTCTTCCTCGATCTCCGGCGACTCTCCGGCATGTTGCAGCGTCGTCGATGTGCAGGTCCTCCTCTGGAAATGCTCGGTGTTGCCAGGCGCTCTATCCCTCGCTCCGCTGCTCTCACCATTCGTTCTCTATATCTGAAACGACCAACGACGGGCATTTTGTGCCTTCGTGCGGCTGA...

Protein

Download Protein FASTA

2502 aa · LXL04_021827|LXL04_021827|OH1004|PROTEIN

MEATACFLNLRRPCSDLRREDPSSSRIALFLDLRRLSGMLQRRRCAGPPLEMLGVARRSIPRSAALTIRSLYLKRPTTGILCLRAADNVEDEDESKSHVPKVFDKMLERNCVYIKPFNMPNALYHSSSYTVTIPFVAPDVEEESMDTQSSTELKKLLETMEADKRDMEQQLKVMQYQIQELVLSGNRRTNGDNSNSGESIYKEGTSGGRTNDIKVEPTVESPSTDIEVEEVVEPTVESPLTDIEVEEVIGPDDGECLVVL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021827`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_021827`
Location	Chr04:137739145-137755534 (+)
Description	Similar to TY3B-I: Transposon Ty3-I Gag-Pol polyprotein (Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_021827` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006310 DNA recombination Biological Process GO:0006508 proteolysis Biological Process GO:0015074 DNA integration Biological Process GO:0075523 viral translational frameshifting Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0003677 DNA binding Molecular Function GO:0003723 RNA binding Molecular Function GO:0003887 DNA-directed DNA polymerase activity Molecular Function GO:0003964 RNA-directed DNA polymerase activity Molecular Function GO:0004190 aspartic-type endopeptidase activity Molecular Function GO:0004523 RNA-DNA hybrid ribonuclease activity Molecular Function
KEGG gene cross-reference	sce:YGR109W-B sce:YIL082W-A These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.615

Rank 1 · LXL04_021827 · OH-1004

Nucleus0.319

Rank 2 · LXL04_021827 · OH-1004

Mitochondrion0.100

Rank 3 · LXL04_021827 · OH-1004

Endoplasmic reticulum0.066

Rank 4 · LXL04_021827 · OH-1004

Cell membrane0.059

Rank 5 · LXL04_021827 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00078.33RVT_1503-588 aa

PF17919.8RT_RNaseH_2607-698 aa

PF17917.8RT_RNaseH631-728 aa

PF17921.8Integrase_H2C2810-866 aa

PF31073.1DUF88031097-1162 aa

PF24626.2SH3_Tf2-11100-1161 aa

PF00078.33RVT_11801-1886 aa

PF17919.8RT_RNaseH_21905-1996 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021827	`PF00078.33`	RVT_1	503	588	2.5e-17	64.1
LXL04_021827	`PF17919.8`	RT_RNaseH_2	607	698	6.5e-59	196.9
LXL04_021827	`PF17917.8`	RT_RNaseH	631	728	3.7e-59	198.1
LXL04_021827	`PF17921.8`	Integrase_H2C2	810	866	1.5e-36	125.0
LXL04_021827	`PF31073.1`	DUF8803	1097	1162	5.5e-11	42.8
LXL04_021827	`PF24626.2`	SH3_Tf2-1	1100	1161	6.7e-35	119.7
LXL04_021827	`PF00078.33`	RVT_1	1801	1886	2.5e-17	64.1
LXL04_021827	`PF17919.8`	RT_RNaseH_2	1905	1996	6.5e-59	196.9
LXL04_021827	`PF17917.8`	RT_RNaseH	1929	2026	3.7e-59	198.1
LXL04_021827	`PF17921.8`	Integrase_H2C2	2108	2164	1.5e-36	125.0
LXL04_021827	`PF31073.1`	DUF8803	2395	2460	5.5e-11	42.8
LXL04_021827	`PF24626.2`	SH3_Tf2-1	2398	2459	6.7e-35	119.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card