LXL04_021776 | RubberDandelionOmics

Gene overview

LXL04_021776

Reference: OH-1004 Chr: Chr04 Coordinates: 136759331-136771836 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1773 bp · LXL04_021776|LXL04_021776|OH1004|cDNA

ATGACCGACAAATTTCAAGCGAGTATCGCCTCCTCTAAAGCTAAGAAAAACATGACTAAAACTACAATTTTAACAACTAAAGGGACCATTTTTACAATTTTGTCTAACTTGTCACTGCATATTGCAACATATGTTAAAGTTGAAACCCAAAACCCTCCCAAACCCCACTCACCGACCCCAACCCGACTATCCTCATCCTATTCCAAGCTCTTCTGCACAGGGATGATAATGGCAGCTGCCACCACAACCGCTTCTCATCT...

CDS

Download CDS FASTA

1773 bp · LXL04_021776|LXL04_021776|OH1004|CDS

ATGACCGACAAATTTCAAGCGAGTATCGCCTCCTCTAAAGCTAAGAAAAACATGACTAAAACTACAATTTTAACAACTAAAGGGACCATTTTTACAATTTTGTCTAACTTGTCACTGCATATTGCAACATATGTTAAAGTTGAAACCCAAAACCCTCCCAAACCCCACTCACCGACCCCAACCCGACTATCCTCATCCTATTCCAAGCTCTTCTGCACAGGGATGATAATGGCAGCTGCCACCACAACCGCTTCTCATCT...

Protein

Download Protein FASTA

590 aa · LXL04_021776|LXL04_021776|OH1004|PROTEIN

MTDKFQASIASSKAKKNMTKTTILTTKGTIFTILSNLSLHIATYVKVETQNPPKPHSPTPTRLSSSYSKLFCTGMIMAAATTTASHLTSFLSTPELCRLSRSLQSPQRQRRSTRKSVPGTISASVNLKPPPYPLNALEPHMSKETLEYHWGKHQRSYVDNLNKQIEGTELDEMSLETIISTSYNKGDVLPAFNNAAQVWNHEFFWESMKPNGGGKPSGELLELINRDFGSFDGLINEFKSAAVTQFGSGWAWLHKLDIPN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021776`
TK1151 ID	TkA05G420300
OH-1004 ID	LXL04_021776
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.700
Protein coverage (%)	TK1151 95.806 / OH-1004 49.661 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021776

Location Chr04:136759331-136771836 (+)

Description Similar to FSD2: Superoxide dismutase [Fe] 2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g51100`	Destroys superoxide anion radicals which are normally produced within the cells and which are toxic to biological systems (By similarity).	A heterocomplex of iron superoxide dismutases defends chloroplast nucleoids against oxidative stress and is essential for chloroplast development in Arabidopsis.2008 · DOI: 10.1105/tpc.108.061341
`At4g25100`	Destroys superoxide anion radicals which are normally produced within the cells and which are toxic to biological systems.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0115400`	Destroys superoxide anion radicals which are normally produced within the cells and which are toxic to biological systems.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021776 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009411 response to UV Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0000427 plastid-encoded plastid RNA polymerase complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009534 chloroplast thylakoid Cellular Component

GO:0009579 thylakoid Cellular Component

GO:0042644 chloroplast nucleoid Cellular Component

GO:0004784 superoxide dismutase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT5G51100

gmx:547823

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.942

Rank 1 · LXL04_021776 · OH-1004

Cytoplasm0.077

Rank 2 · LXL04_021776 · OH-1004

Mitochondrion0.051

Rank 3 · LXL04_021776 · OH-1004

Peroxisome0.046

Rank 4 · LXL04_021776 · OH-1004

Cell membrane0.028

Rank 5 · LXL04_021776 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00081.28Sod_Fe_N127-208 aa

PF02777.24Sod_Fe_C216-330 aa

PF00081.28Sod_Fe_N400-481 aa

PF02777.24Sod_Fe_C489-582 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021776	`PF00081.28`	Sod_Fe_N	127	208	2.6e-48	163.1
LXL04_021776	`PF02777.24`	Sod_Fe_C	216	330	2.8e-58	195.1
LXL04_021776	`PF00081.28`	Sod_Fe_N	400	481	2.6e-48	163.1
LXL04_021776	`PF02777.24`	Sod_Fe_C	489	582	2.8e-58	195.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LU64`	Arabidopsis thaliana	Superoxide dismutase [Fe] 2, chloroplastic	64.259%	Swiss-Prot	weak database homology
`P21276`	Arabidopsis thaliana	Superoxide dismutase [Fe] 1, chloroplastic	63.393%	Swiss-Prot	weak database homology
`Q5VRL3`	Oryza sativa subsp. japonica	Superoxide dismutase [Fe] 1, chloroplastic	56.250%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card