LXL04_021746 | RubberDandelionOmics

Gene overview

LXL04_021746

Reference: OH-1004 Chr: Chr04 Coordinates: 136229313-136232135 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1125 bp · LXL04_021746|LXL04_021746|OH1004|cDNA

ATGCCTTCAGTCGTTTCACCTCAGTGGCAAGAAAAGGCCACTGGTTTCTTCTCATCTTCAGGGACAAAACTGAAAGAAGCTGGACAATCTGCAGGAAGTTTTGTAGGCGAAGTGGCTAAAGATGCAAAAGGGAATGTTTCAGAAGTTGCGGGAAAATTAGGGTCTGTAGTGAAAAGTCGATGGTCTCTTTTTCAACAGCCATCAACAAGACAAGCGATGCAGGAAAGACTAGTGAATGCTGCTGCTACTACAAGTTTTTT...

CDS

Download CDS FASTA

1125 bp · LXL04_021746|LXL04_021746|OH1004|CDS

ATGCCTTCAGTCGTTTCACCTCAGTGGCAAGAAAAGGCCACTGGTTTCTTCTCATCTTCAGGGACAAAACTGAAAGAAGCTGGACAATCTGCAGGAAGTTTTGTAGGCGAAGTGGCTAAAGATGCAAAAGGGAATGTTTCAGAAGTTGCGGGAAAATTAGGGTCTGTAGTGAAAAGTCGATGGTCTCTTTTTCAACAGCCATCAACAAGACAAGCGATGCAGGAAAGACTAGTGAATGCTGCTGCTACTACAAGTTTTTT...

Protein

Download Protein FASTA

374 aa · LXL04_021746|LXL04_021746|OH1004|PROTEIN

MPSVVSPQWQEKATGFFSSSGTKLKEAGQSAGSFVGEVAKDAKGNVSEVAGKLGSVVKSRWSLFQQPSTRQAMQERLVNAAATTSFFLRRGVSETKEKVVVGKTKVEEVAKKTAQKSKTLLTDIERWQKGVASTDVFGVPIEVTVQRQESSKPVPFLLIKCADYLVLSGLNSPDLFKSEGNKKAIHHLVSLYNQDLNAPLPENVNANDVAALVKCYLASLPQPLISPDLQNEVRGSRSSIPQMRNILKKLPSVNYMTLEL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021746`
TK1151 ID	TkA05G418380
OH-1004 ID	LXL04_021746
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021746

Location Chr04:136229313-136232135 (-)

Description Similar to At5g61530: Uncharacterized Rho GTPase-activating protein At5g61530

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g61530`	Uncharacterized Rho GTPase-activating protein At5g61530.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021746 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0007165 signal transduction Biological Process

GO:0007264 small GTPase-mediated signal transduction Biological Process

GO:0007266 Rho protein signal transduction Biological Process

GO:0008064 regulation of actin polymerization or depolymerization Biological Process

GO:0008360 regulation of cell shape Biological Process

GO:0008361 regulation of cell size Biological Process

GO:0016477 cell migration Biological Process

GO:0030950 establishment or maintenance of actin cytoskeleton polarity Biological Process

GO:0032956 regulation of actin cytoskeleton organization Biological Process

GO:0035024 negative regulation of Rho protein signal transduction Biological Process

GO:0043116 negative regulation of vascular permeability Biological Process

KEGG gene cross-reference

ath:AT5G61530

dme:Dmel_CG6811

hsa:2909

rno:306400

xla:414634

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.461

Rank 1 · LXL04_021746 · OH-1004

Golgi apparatus0.216

Rank 2 · LXL04_021746 · OH-1004

Mitochondrion0.173

Rank 3 · LXL04_021746 · OH-1004

Cell membrane0.162

Rank 4 · LXL04_021746 · OH-1004

Nucleus0.139

Rank 5 · LXL04_021746 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00620.33RhoGAP155-294 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021746	`PF00620.33`	RhoGAP	155	294	1.7e-28	100.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q3E875`	Arabidopsis thaliana	Uncharacterized Rho GTPase-activating protein At5g61530	66.931%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card