LXL04_021619 | RubberDandelionOmics

Gene overview

LXL04_021619

Reference: OH-1004 Chr: Chr04 Coordinates: 133762001-133763587 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1587 bp · LXL04_021619|LXL04_021619|OH1004|cDNA

ATGGCTTCGAATAACCTATCCGTACTAGAAGCACTCGATACAGCTCGCACACAATGGTACCATGCAAAAGCCATCATCATCGCCGGATCGGGTTTCTTCACTGACGCATACGATCTTTTCTGTATAACCACTGTATCCAAACTCTTAGGTCGTCTTTACTTCTCCAACGGTGGCTCAGACCCTGGAAAACTCCCCACTCACATCAACAACGCTGTGACCGGTGTAGCCCTGATCGGGACCCTAACAGGACAACTGGTATT...

CDS

Download CDS FASTA

1587 bp · LXL04_021619|LXL04_021619|OH1004|CDS

ATGGCTTCGAATAACCTATCCGTACTAGAAGCACTCGATACAGCTCGCACACAATGGTACCATGCAAAAGCCATCATCATCGCCGGATCGGGTTTCTTCACTGACGCATACGATCTTTTCTGTATAACCACTGTATCCAAACTCTTAGGTCGTCTTTACTTCTCCAACGGTGGCTCAGACCCTGGAAAACTCCCCACTCACATCAACAACGCTGTGACCGGTGTAGCCCTGATCGGGACCCTAACAGGACAACTGGTATT...

Protein

Download Protein FASTA

528 aa · LXL04_021619|LXL04_021619|OH1004|PROTEIN

MASNNLSVLEALDTARTQWYHAKAIIIAGSGFFTDAYDLFCITTVSKLLGRLYFSNGGSDPGKLPTHINNAVTGVALIGTLTGQLVFGWLGDKLGRKKVYGVTLILMVICALCSGLSFGYTPKAVIGTLCFFRFWLGFGIGGDYPLSATIMSEYANKKTRGSFIAAVFAMQGVGIIFAGLVSMIVSSIFLKANPAPSFNEDHVLSTQSNADFAWRIVLMLGALPALLTYYWRMKMPETGRYTAIIEGNAMQAASDMGRVL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021619`
TK1151 ID	TkA05G411830
OH-1004 ID	LXL04_021619
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	93.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021619

Location Chr04:133762001-133763587 (+)

Description Similar to PT4: Low affinity inorganic phosphate transporter 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0657100`	Symbiosis-specific regulated inorganic phosphate (Pi) transporter.	Rice phosphate transporters include an evolutionarily divergent gene specifically activated in arbuscular mycorrhizal symbiosis.2002 · DOI: 10.1073/pnas.202474599

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021619 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006817 phosphate ion transport Biological Process

GO:0009610 response to symbiotic fungus Biological Process

GO:0010247 detection of phosphate ion Biological Process

GO:0010311 lateral root formation Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0036377 arbuscular mycorrhizal association Biological Process

GO:0043562 cellular response to nitrogen levels Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0085042 periarbuscular membrane Cellular Component

GO:0005315 phosphate transmembrane transporter activity Molecular Function

KEGG gene cross-reference

dosa:Os01g0657100

mtr:25482376

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.669

Rank 1 · LXL04_021619 · OH-1004

Cytoplasm0.141

Rank 2 · LXL04_021619 · OH-1004

Endoplasmic reticulum0.105

Rank 3 · LXL04_021619 · OH-1004

Lysosome / Vacuole0.093

Rank 4 · LXL04_021619 · OH-1004

Golgi apparatus0.062

Rank 5 · LXL04_021619 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00083.31Sugar_tr25-502 aa

PF07690.22MFS_172-454 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021619	`PF00083.31`	Sugar_tr	25	502	4e-52	178.3
LXL04_021619	`PF07690.22`	MFS_1	72	454	2.5e-22	80.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94DB8`	Oryza sativa subsp. japonica	Inorganic phosphate transporter 1-11	74.704%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card