Gene Card
Gene overview
cDNA / CDS / Protein Sequences
657 bp · LXL04_021559|LXL04_021559|OH1004|cDNA
ATGTATTTCGGTCTTCTTCATCTCTGCTTCCGTTCTTCCTGTTCTGCCGGCGAATACTTAATTTTTTTCCCCTCCCTTTTGTTTTGCCTCTTTGCTTTTGTGTTGcttattttcaaatttttgcTTCTTTCTACTCTTTCCCAACTACTCAAGGTCATTGCCGGTGCATACAGTGAGAATGTTCCGGTTATATGTATAGTCGGTGGACCCAATTTCAACGATTATGGGACTAACAGAATTCTTCATCATACAATCGGATT...
657 bp · LXL04_021559|LXL04_021559|OH1004|CDS
ATGTATTTCGGTCTTCTTCATCTCTGCTTCCGTTCTTCCTGTTCTGCCGGCGAATACTTAATTTTTTTCCCCTCCCTTTTGTTTTGCCTCTTTGCTTTTGTGTTGCTTATTTTCAAATTTTTGCTTCTTTCTACTCTTTCCCAACTACTCAAGGTCATTGCCGGTGCATACAGTGAGAATGTTCCGGTTATATGTATAGTCGGTGGACCCAATTTCAACGATTATGGGACTAACAGAATTCTTCATCATACAATCGGATT...
Protein
Download Protein FASTA218 aa · LXL04_021559|LXL04_021559|OH1004|PROTEIN
MYFGLLHLCFRSSCSAGEYLIFFPSLLFCLFAFVLLIFKFLLLSTLSQLLKVIAGAYSENVPVICIVGGPNFNDYGTNRILHHTIGLPDFRQELRCFQTVTYYQAVVNISEDAKELTDTTISTALKESKPVYISVGCNLPAIPHPTFSREPVPFSLPPSTFHKSPSNLKTSFHPECFCCRYPITKHEELVWLKISTMLPIEKSSSMKDWNTLDCVGWI
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_021559 |
|---|---|
| TK1151 ID | TkA05G405870 |
| OH-1004 ID | LXL04_021559 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_021559 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr04:132371310-132372511 (-) | |||||||||
| Description | Similar to PDC1: Pyruvate decarboxylase 1 (Fragment) | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000949 aromatic amino acid family catabolic process to alcohol via Ehrlich pathway Biological Process GO:0001666 response to hypoxia Biological Process GO:0006950 response to stress Biological Process GO:0034059 response to anoxia Biological Process GO:0036293 response to decreased oxygen levels Biological Process GO:0071456 cellular response to hypoxia Biological Process GO:0090548 response to nitrate starvation Biological Process GO:0005829 cytosol Cellular Component GO:0005886 plasma membrane Cellular Component GO:0009507 chloroplast Cellular Component GO:0000287 magnesium ion binding Molecular Function GO:0004737 pyruvate decarboxylase activity Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT4G33070 ath:AT5G01320 nta:107814772 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
No result was found for this query.
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.