LXL04_021524 | RubberDandelionOmics

Gene overview

LXL04_021524

Reference: OH-1004 Chr: Chr04 Coordinates: 131582760-131592936 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3855 bp · LXL04_021524|LXL04_021524|OH1004|cDNA

ATGGCTGTTCCTGTCGAAGAAGCAATTGCTGCTCTTTCTACATTTTCATTAGAGGATGATCAACCAGAGGTGCAAGGCCCAGGATTGTGGGTTTCATCTGAAAGAGGTGCAACAATTAGTCCGATAGAGTATAGTGATGTCCATGCAtatcgactatctctatcagaggACACAAAAGCACTGAATCAACTGAATACTCTTGTACAAGAAGGTAAGGAAATGGTATCAGTCCTGTATGCATACAGGAGCTGTGTCAAAGC...

CDS

Download CDS FASTA

3855 bp · LXL04_021524|LXL04_021524|OH1004|CDS

ATGGCTGTTCCTGTCGAAGAAGCAATTGCTGCTCTTTCTACATTTTCATTAGAGGATGATCAACCAGAGGTGCAAGGCCCAGGATTGTGGGTTTCATCTGAAAGAGGTGCAACAATTAGTCCGATAGAGTATAGTGATGTCCATGCATATCGACTATCTCTATCAGAGGACACAAAAGCACTGAATCAACTGAATACTCTTGTACAAGAAGGTAAGGAAATGGTATCAGTCCTGTATGCATACAGGAGCTGTGTCAAAGC...

Protein

Download Protein FASTA

1284 aa · LXL04_021524|LXL04_021524|OH1004|PROTEIN

MAVPVEEAIAALSTFSLEDDQPEVQGPGLWVSSERGATISPIEYSDVHAYRLSLSEDTKALNQLNTLVQEGKEMVSVLYAYRSCVKALPQLSDSMKQSQADLYLETYQVLDLEMSRLREIQRWQASAASKLAADMQRFSRPERRINGPTVTHLWSMLKLLDVLVQLDHLKNAKASIPNDFSWYKRTFTQVSVQWQDTDSMREELDDLQIFLSTRWAILLNLHVEMFRVNNVEDILQVLIVYAAECLELDFALLFPERHVL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021524`
TK1151 ID	TkA05G401620
OH-1004 ID	LXL04_021524
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021524

Location Chr04:131582760-131592936 (+)

Description Similar to PIR: Protein PIR

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g18410`	Involved in regulation of actin and microtubule organization.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021524 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000281 mitotic cytokinesis Biological Process

GO:0000902 cell morphogenesis Biological Process

GO:0006417 regulation of translation Biological Process

GO:0008360 regulation of cell shape Biological Process

GO:0010090 trichome morphogenesis Biological Process

GO:0030031 cell projection assembly Biological Process

GO:0030032 lamellipodium assembly Biological Process

GO:0030036 actin cytoskeleton organization Biological Process

GO:0030833 regulation of actin filament polymerization Biological Process

GO:0030835 negative regulation of actin filament depolymerization Biological Process

GO:0031269 pseudopodium assembly Biological Process

GO:0031529 ruffle organization Biological Process

KEGG gene cross-reference

ath:AT5G18410

ddi:DDB_G0287855

dre:336613

mmu:76884

pon:100173465

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.657

Rank 1 · LXL04_021524 · OH-1004

Nucleus0.226

Rank 2 · LXL04_021524 · OH-1004

Cell membrane0.161

Rank 3 · LXL04_021524 · OH-1004

Golgi apparatus0.140

Rank 4 · LXL04_021524 · OH-1004

Lysosome / Vacuole0.105

Rank 5 · LXL04_021524 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07159.18CYRIA-B_Rac1-bd57-219 aa

PF05994.17FragX_IP345-1245 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021524	`PF07159.18`	CYRIA-B_Rac1-bd	57	219	1.5e-06	28.4
LXL04_021524	`PF05994.17`	FragX_IP	345	1245		1050.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5S2C3`	Arabidopsis thaliana	Protein PIR	80.512%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card