LXL04_021455 | RubberDandelionOmics

Gene overview

LXL04_021455

Reference: OH-1004 Chr: Chr04 Coordinates: 130448459-130450035 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1254 bp · LXL04_021455|LXL04_021455|OH1004|cDNA

ACTTTCGTGACTAGGGTTTCTCATTGCTTTTTGTTGTTCACAGCCTCCTGCTATCGTCTTCTCCTGCACGCCCTCTGGTCGAGACAGAGAAAGCAAGAAAAAATGGCGGATTCGTTGGTGCTACGCGGCACCATGAGAGCTCATACCGACTGGGTTACAGCAATCGCCACCCCAATTGACAACTCCGATATGATCGTCACCTCATCACGTGACAAATCTATAATCGTTTGGCGTCTAACAAAAGAAGACAAAACCTACGG...

CDS

Download CDS FASTA

1062 bp · LXL04_021455|LXL04_021455|OH1004|CDS

TTGTTGTTCACAGCCTCCTGCTATCGTCTTCTCCTGCACGCCCTCTGGTCGAGACAGAGAAAGCAAGAAAAAATGGCGGATTCGTTGGTGCTACGCGGCACCATGAGAGCTCATACCGACTGGGTTACAGCAATCGCCACCCCAATTGACAACTCCGATATGATCGTCACCTCATCACGTGACAAATCTATAATCGTTTGGCGTCTAACAAAAGAAGACAAAACCTACGGTGTTGCCCAACGCCGTCTCACAGGCCACTC...

Protein

Download Protein FASTA

353 aa · LXL04_021455|LXL04_021455|OH1004|PROTEIN

MLFTASCYRLLLHALWSRQRKQEKMADSLVLRGTMRAHTDWVTAIATPIDNSDMIVTSSRDKSIIVWRLTKEDKTYGVAQRRLTGHSHFVQDVVLSSDGQFALSGSWDGELRLWDLNAGTTARRFVGHTKDVLSVAFSIDNRQIVSASRDKSIKLWNTLGECKYTIQDGDAHNDWVSCVRFSPNTLQPTIVSASWDKTVKIWNLTNCKLRSTLAGHGGYVNTVAVSPDGSLCASGGKDGMILLWDLAEGKRLYSLESASI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021455`
TK1151 ID	TkA05G397010
OH-1004 ID	LXL04_021455
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 84.856 / OH-1004 92.068 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021455

Location Chr04:130448459-130450035 (+)

Description Similar to GB1: Guanine nucleotide-binding protein subunit beta-like protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g18080`	Major component of the RACK1 regulatory proteins that play a role in multiple signal transduction pathways.	RACK1 mediates multiple hormone responsiveness and developmental processes in Arabidopsis.2006 · DOI: 10.1093/jxb/erl035 Structure of a signal transduction regulator, RACK1, from Arabidopsis thaliana.2008 · DOI: 10.1110/ps.035121.108 RACK1 genes regulate plant development with unequal genetic redundancy in Arabidopsis.2008 · DOI: 10.1186/1471-2229-8-108

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021455 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006417 regulation of translation Biological Process

GO:0009739 response to gibberellin Biological Process

GO:0009749 response to glucose Biological Process

GO:0009845 seed germination Biological Process

GO:0009967 positive regulation of signal transduction Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

GO:0010476 gibberellin mediated signaling pathway Biological Process

GO:0042254 ribosome biogenesis Biological Process

GO:0071215 cellular response to abscisic acid stimulus Biological Process

GO:0072344 rescue of stalled cytosolic ribosome Biological Process

GO:2001125 negative regulation of translational frameshifting Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G18080

gmx:547868

nta:107763849

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.514

Rank 1 · LXL04_021455 · OH-1004

Nucleus0.439

Rank 2 · LXL04_021455 · OH-1004

Cell membrane0.091

Rank 3 · LXL04_021455 · OH-1004

Lysosome / Vacuole0.081

Rank 4 · LXL04_021455 · OH-1004

Golgi apparatus0.055

Rank 5 · LXL04_021455 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23869.2Beta-prop_WDR75_1st4-119 aa

PF25047.1Beta-prop_TEP1_2nd12-161 aa

PF23775.2Beta-prop_RIG_2nd20-145 aa

PF24105.2Beta-prop_CAF1B_HIR121-122 aa

PF25175.2Beta-prop_WDR530-185 aa

PF00400.39WD4032-67 aa

PF23381.2Beta-prop_IFT122_1st32-209 aa

PF25173.2Beta-prop_WDR3_1st32-157 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021455	`PF23869.2`	Beta-prop_WDR75_1st	4	119	4.4e-14	53.2
LXL04_021455	`PF25047.1`	Beta-prop_TEP1_2nd	12	161	1.3e-26	94.0
LXL04_021455	`PF23775.2`	Beta-prop_RIG_2nd	20	145	8.8e-11	42.5
LXL04_021455	`PF24105.2`	Beta-prop_CAF1B_HIR1	21	122	1.2e-24	87.7
LXL04_021455	`PF25175.2`	Beta-prop_WDR5	30	185	1.3e-52	179.7
LXL04_021455	`PF00400.39`	WD40	32	67	4e-60	198.4
LXL04_021455	`PF23381.2`	Beta-prop_IFT122_1st	32	209	2e-54	185.5
LXL04_021455	`PF25173.2`	Beta-prop_WDR3_1st	32	157	5.3e-48	163.9
LXL04_021455	`PF25174.2`	Beta-prop_THOC3	32	274	3.1e-45	155.0
LXL04_021455	`PF24814.2`	WD40_Prp19	33	122	1.5e-44	152.9
LXL04_021455	`PF24807.2`	WD40_CDC20-Fz	34	244	3.6e-35	122.4
LXL04_021455	`PF23414.2`	Beta-prop_EML_2	34	121	8e-25	88.4
LXL04_021455	`PF23409.2`	Beta-prop_EML	34	158	8.3e-13	49.2
LXL04_021455	`PF25172.2`	Beta-prop_WDR3_2nd	35	115	6.2e-36	124.8
LXL04_021455	`PF23609.2`	Beta-prop_EIPR1	35	114	8.5e-13	49.1
LXL04_021455	`PF24817.2`	WD40_WDHD1_1st	40	268	1.5e-31	110.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O24456`	Arabidopsis thaliana	Small ribosomal subunit protein RACK1z	83.333%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card