LXL04_021338 | RubberDandelionOmics

Gene overview

LXL04_021338

Reference: OH-1004 Chr: Chr04 Coordinates: 127587614-127588579 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

966 bp · LXL04_021338|LXL04_021338|OH1004|cDNA

ATGATAGGGGTTCTTCGTAGGAAGTTAGCCCAATTCTTACAAATGGATATTTCTTCCGACGAATCACCTACATCCATCCACGAAAACGGTCAACACCATGAGAAAATAAGCAAAAAACTAGCAGAAATCACATCTACGGCTTCAAAAAACAGCGAATGGGCAAGTTTCAGGGATCTTTACCAATATCAAGGCTTTTGGTATTACGAGGGATTCCTAGAAAAGATTTTGCAAGCTCAAGAACAATTCAAAGCTCAACCTAG...

CDS

Download CDS FASTA

966 bp · LXL04_021338|LXL04_021338|OH1004|CDS

ATGATAGGGGTTCTTCGTAGGAAGTTAGCCCAATTCTTACAAATGGATATTTCTTCCGACGAATCACCTACATCCATCCACGAAAACGGTCAACACCATGAGAAAATAAGCAAAAAACTAGCAGAAATCACATCTACGGCTTCAAAAAACAGCGAATGGGCAAGTTTCAGGGATCTTTACCAATATCAAGGCTTTTGGTATTACGAGGGATTCCTAGAAAAGATTTTGCAAGCTCAAGAACAATTCAAAGCTCAACCTAG...

Protein

Download Protein FASTA

321 aa · LXL04_021338|LXL04_021338|OH1004|PROTEIN

MIGVLRRKLAQFLQMDISSDESPTSIHENGQHHEKISKKLAEITSTASKNSEWASFRDLYQYQGFWYYEGFLEKILQAQEQFKAQPSDIILCTPPGSNALRLQTLAFAIMNRSTTSSAESANYLQTEVPCLEMDLFPMKKHVVSSNPKVPLLFTTNIPYTSLPKSIIDSKCKIVYMCRNPKDVIVSQWRSLGASDLDRIPLIKAYRSFCKGVSNYGPFWDHVLGFWETTMKSPDRVLFLTYEKLESETSFNVRRLAQFLG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021338`
TK1151 ID	TkA05G381510
OH-1004 ID	LXL04_021338
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.400
Protein coverage (%)	TK1151 100.000 / OH-1004 95.639 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021338

Location Chr04:127587614-127588579 (+)

Description Similar to Flavonol sulfotransferase-like

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g18590`	Sulfotransferase that utilizes 3'-phospho-5'-adenylyl sulfate (PAPS) as sulfonate donor to catalyze the sulfate conjugation of desulfo-glucosinolates (dsGSs), the final step in the biosynthesis of the glucosinolate core structure.	Desulfoglucosinolate sulfotransferases from Arabidopsis thaliana catalyze the final step in the biosynthesis of the glucosinolate core structure.2004 · DOI: 10.1074/jbc.m407681200 The three desulfoglucosinolate sulfotransferase proteins in Arabidopsis have different substrate specificities and are differentially expressed.2006 · DOI: 10.1111/j.1742-4658.2005.05048.x Kinetics and substrate specificities of desulfo-glucosinolate sulfotransferases in Arabidopsis thaliana.2009 · DOI: 10.1111/j.1399-3054.2008.01182.x
`At1g74100`	Sulfotransferase that utilizes 3'-phospho-5'-adenylyl sulfate (PAPS) as sulfonate donor to catalyze the sulfate conjugation of desulfo-glucosinolates (dsGSs), the final step in the biosynthesis of the glucosinolate core structure.	Desulfoglucosinolate sulfotransferases from Arabidopsis thaliana catalyze the final step in the biosynthesis of the glucosinolate core structure.2004 · DOI: 10.1074/jbc.m407681200 The three desulfoglucosinolate sulfotransferase proteins in Arabidopsis have different substrate specificities and are differentially expressed.2006 · DOI: 10.1111/j.1742-4658.2005.05048.x Kinetics and substrate specificities of desulfo-glucosinolate sulfotransferases in Arabidopsis thaliana.2009 · DOI: 10.1111/j.1399-3054.2008.01182.x Modulation of sulfur metabolism enables efficient glucosinolate engineering.2011 · DOI: 10.1186/1472-6750-11-12
`At2g03760`	Sulfotransferase that utilizes 3'-phospho-5'-adenylyl sulfate (PAPS) as sulfonate donor to catalyze the stereospecific sulfate conjugation of 24-epibrassinosteroids.	Molecular and biochemical characterization of two brassinosteroid sulfotransferases from Arabidopsis, AtST4a (At2g14920) and AtST1 (At2g03760).2007 · DOI: 10.1007/s00425-006-0413-y A stress-inducible sulphotransferase sulphonates salicylic acid and confers pathogen resistance in Arabidopsis.2010 · DOI: 10.1111/j.1365-3040.2010.02156.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021338 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009751 response to salicylic acid Biological Process

GO:0016131 brassinosteroid metabolic process Biological Process

GO:0019761 glucosinolate biosynthetic process Biological Process

GO:0032260 response to jasmonic acid stimulus involved in jasmonic acid and ethylene-dependent systemic resistance Biological Process

GO:0051923 sulfation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0008146 sulfotransferase activity Molecular Function

KEGG gene cross-reference

ag:AAA33343

ath:AT1G18590

ath:AT1G74100

ath:AT2G03760

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.798

Rank 1 · LXL04_021338 · OH-1004

Nucleus0.263

Rank 2 · LXL04_021338 · OH-1004

Endoplasmic reticulum0.063

Rank 3 · LXL04_021338 · OH-1004

Mitochondrion0.041

Rank 4 · LXL04_021338 · OH-1004

Cell membrane0.040

Rank 5 · LXL04_021338 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00685.34Sulfotransfer_186-299 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021338	`PF00685.34`	Sulfotransfer_1	86	299	2.1e-42	146.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FZ80`	Arabidopsis thaliana	Cytosolic sulfotransferase 17	33.837%	Swiss-Prot	moderate database homology
`Q9C9D0`	Arabidopsis thaliana	Cytosolic sulfotransferase 16	34.796%	Swiss-Prot	moderate database homology
`P52839`	Arabidopsis thaliana	Cytosolic sulfotransferase 12	35.256%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card