LXL04_021312 | RubberDandelionOmics

Gene overview

LXL04_021312

Reference: OH-1004 Chr: Chr04 Coordinates: 127042693-127044275 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1170 bp · LXL04_021312|LXL04_021312|OH1004|cDNA

ATGGATAGATATTGTGAATTCTGTGTGAATTTGAGATCAGTTGTTTACTGTAAGGCCGATGCAGCCTATCTTTGTCTTTCATGTGATACAAAGGTTCACTCAGCAAATCCGCTCTCCAACCGCCATTATCGGAACCTCATTTGTGAGTCTTGCAGACGTCGCCCAACATATGTTCATTGTTATGATCATCAGAAGTTCATGTGTCGTGGGTGTGACCTTAGCCAACACAATGCTTCTTCTAAGCATAAAAAGAAAGTTGT...

CDS

Download CDS FASTA

1170 bp · LXL04_021312|LXL04_021312|OH1004|CDS

ATGGATAGATATTGTGAATTCTGTGTGAATTTGAGATCAGTTGTTTACTGTAAGGCCGATGCAGCCTATCTTTGTCTTTCATGTGATACAAAGGTTCACTCAGCAAATCCGCTCTCCAACCGCCATTATCGGAACCTCATTTGTGAGTCTTGCAGACGTCGCCCAACATATGTTCATTGTTATGATCATCAGAAGTTCATGTGTCGTGGGTGTGACCTTAGCCAACACAATGCTTCTTCTAAGCATAAAAAGAAAGTTGT...

Protein

Download Protein FASTA

389 aa · LXL04_021312|LXL04_021312|OH1004|PROTEIN

MDRYCEFCVNLRSVVYCKADAAYLCLSCDTKVHSANPLSNRHYRNLICESCRRRPTYVHCYDHQKFMCRGCDLSQHNASSKHKKKVVKSYVGCPSARDLGVLWGFNLNPFIDGSRILEYKFCVETNDQIKGSDRGIQAFSVLEQLVDLLKVQTSDVDHISSVMTWQQREVENDVDQFSQQSMFERGGNPDNHDIILDSSSFPFIHLDHLESSDPNKTTLQDSFWQWKSSASTSQLWCHNMQDLGVCEEEPSCLDDLDIPD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021312`
TK1151 ID	TkA05G379070
OH-1004 ID	LXL04_021312
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 58.355 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021312

Location Chr04:127042693-127044275 (+)

Description Similar to At1g68190: Putative zinc finger protein At1g68190

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g68190`	Putative zinc finger protein At1g68190.	No verified direct reference in this release
`At3g07650`	Zinc finger protein CONSTANS-LIKE 9.	No verified direct reference in this release
`At5g48250`	Zinc finger protein CONSTANS-LIKE 10.	No verified direct reference in this release
`At4g15250`	Putative zinc finger protein CONSTANS-LIKE 11.	No verified direct reference in this release
`At2g47890`	Zinc finger protein CONSTANS-LIKE 13.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021312 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009637 response to blue light Biological Process

GO:0010114 response to red light Biological Process

GO:0010218 response to far red light Biological Process

GO:0048579 negative regulation of long-day photoperiodism, flowering Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G68190

ath:AT2G47890

ath:AT3G07650

ath:AT4G15250

ath:AT5G48250

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.932

Rank 1 · LXL04_021312 · OH-1004

Cytoplasm0.152

Rank 2 · LXL04_021312 · OH-1004

Cell membrane0.036

Rank 3 · LXL04_021312 · OH-1004

Endoplasmic reticulum0.019

Rank 4 · LXL04_021312 · OH-1004

Mitochondrion0.013

Rank 5 · LXL04_021312 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C9F4`	Arabidopsis thaliana	Putative zinc finger protein At1g68190	40.214%	Swiss-Prot	moderate database homology
`Q9SSE5`	Arabidopsis thaliana	Zinc finger protein CONSTANS-LIKE 9	28.866%	Swiss-Prot	weak database homology
`Q9LUA9`	Arabidopsis thaliana	Zinc finger protein CONSTANS-LIKE 10	40.268%	Swiss-Prot	weak database homology
`O23379`	Arabidopsis thaliana	Putative zinc finger protein CONSTANS-LIKE 11	42.857%	Swiss-Prot	weak database homology
`O82256`	Arabidopsis thaliana	Zinc finger protein CONSTANS-LIKE 13	36.691%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card