LXL04_021292 | RubberDandelionOmics

Gene overview

LXL04_021292

Reference: OH-1004 Chr: Chr04 Coordinates: 126780068-126781342 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

624 bp · LXL04_021292|LXL04_021292|OH1004|cDNA

ATGCACAATCGGATCGGATTAACTTGTGACTGTTCGACGATTGAAGGGAGACGGCAAGCGTACCACTCGTTTATTGTAGTAGAGGGTGCGTTTGCTTACTTGAGAGATAATACGGCAACAAAGGCCACAATTGGGAATTCAACTATTGTAGATGTTTCAATGGAGTGTGCGGGAATGTTAGAGAGGTTGATGCTAGCTCAAACGCAGGAATGTGTATTTGAGAACACAATTGCTAAAGGGAGCACTTTTGGGGTTTGTAC...

CDS

Download CDS FASTA

624 bp · LXL04_021292|LXL04_021292|OH1004|CDS

ATGCACAATCGGATCGGATTAACTTGTGACTGTTCGACGATTGAAGGGAGACGGCAAGCGTACCACTCGTTTATTGTAGTAGAGGGTGCGTTTGCTTACTTGAGAGATAATACGGCAACAAAGGCCACAATTGGGAATTCAACTATTGTAGATGTTTCAATGGAGTGTGCGGGAATGTTAGAGAGGTTGATGCTAGCTCAAACGCAGGAATGTGTATTTGAGAACACAATTGCTAAAGGGAGCACTTTTGGGGTTTGTAC...

Protein

Download Protein FASTA

207 aa · LXL04_021292|LXL04_021292|OH1004|PROTEIN

MHNRIGLTCDCSTIEGRRQAYHSFIVVEGAFAYLRDNTATKATIGNSTIVDVSMECAGMLERLMLAQTQECVFENTIAKGSTFGVCTKISRQASLYYEGKVAALNATPLDQHFDKIWMSHVQLKAVLFYAEACYREDVEAVQVSGGPTGLQGELQQLHDLRRVNHELFVQTEELLQKEAAKYGHFRSQFGSKWTMPRSTTLTNNLQD

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021292`
TK1151 ID	TkA05G378080
OH-1004 ID	LXL04_021292
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021292

Location Chr04:126780068-126781342 (-)

Description Similar to BRO1: Vacuolar-sorting protein BRO1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g15130`	Class E VPS protein involved in concentration and sorting of cargo proteins of the multivesicular body (MVB) for incorporation into intralumenal vesicles.	Arabidopsis ALIX is required for the endosomal localization of the deubiquitinating enzyme AMSH3.2015 · DOI: 10.1073/pnas.1510516112 ESCRT-III-Associated Protein ALIX Mediates High-Affinity Phosphate Transporter Trafficking to Maintain Phosphate Homeostasis in Arabidopsis.2015 · DOI: 10.1105/tpc.15.00393

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021292 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0003094 glomerular filtration Biological Process

GO:0007033 vacuole organization Biological Process

GO:0007165 signal transduction Biological Process

GO:0009653 anatomical structure morphogenesis Biological Process

GO:0019722 calcium-mediated signaling Biological Process

GO:0036257 multivesicular body organization Biological Process

GO:0043328 protein transport to vacuole involved in ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway Biological Process

GO:0045881 positive regulation of sporulation resulting in formation of a cellular spore Biological Process

GO:0048041 focal adhesion assembly Biological Process

GO:0051497 negative regulation of stress fiber assembly Biological Process

GO:0097018 renal albumin absorption Biological Process

GO:0099638 endosome to plasma membrane protein transport Biological Process

KEGG gene cross-reference

ath:AT1G15130

ddi:DDB_G0275451

mmu:14787

ncr:NCU08001

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.693

Rank 1 · LXL04_021292 · OH-1004

Nucleus0.304

Rank 2 · LXL04_021292 · OH-1004

Cell membrane0.062

Rank 3 · LXL04_021292 · OH-1004

Mitochondrion0.055

Rank 4 · LXL04_021292 · OH-1004

Endoplasmic reticulum0.053

Rank 5 · LXL04_021292 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03097.25BRO12-138 aa

PF13949.12ALIX_LYPXL_bnd135-206 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021292	`PF03097.25`	BRO1	2	138	4.6e-26	92.3
LXL04_021292	`PF13949.12`	ALIX_LYPXL_bnd	135	206	7.4e-12	45.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4HXZ1`	Arabidopsis thaliana	Vacuolar-sorting protein BRO1	64.925%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card