LXL04_021278 | RubberDandelionOmics

Gene overview

LXL04_021278

Reference: OH-1004 Chr: Chr04 Coordinates: 126455832-126457786 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1119 bp · LXL04_021278|LXL04_021278|OH1004|cDNA

ATGGTGTCGGAGAGGTCAGGTTCAAGGAACATATATAAGAGGTTCAAGGGAAGAGGGAGAAAGGGAGAAGAAGGAAAGGAGCTCGGGAAGGCAACACTGCTGGAGTTCGGTTCGGAGAGTTCGTCGGCTTCTTTGGATTCACAACCTTCGACACCGCACGCCCTGACGCCCTTACTTGTTTTGCCTTGGTTGAAGTCTTCTCCCATATCGAACGCCACCAAAATGGACTACAATTTTACAATGCAGCTCTTAGCAATCAT...

CDS

Download CDS FASTA

1119 bp · LXL04_021278|LXL04_021278|OH1004|CDS

ATGGTGTCGGAGAGGTCAGGTTCAAGGAACATATATAAGAGGTTCAAGGGAAGAGGGAGAAAGGGAGAAGAAGGAAAGGAGCTCGGGAAGGCAACACTGCTGGAGTTCGGTTCGGAGAGTTCGTCGGCTTCTTTGGATTCACAACCTTCGACACCGCACGCCCTGACGCCCTTACTTGTTTTGCCTTGGTTGAAGTCTTCTCCCATATCGAACGCCACCAAAATGGACTACAATTTTACAATGCAGCTCTTAGCAATCAT...

Protein

Download Protein FASTA

372 aa · LXL04_021278|LXL04_021278|OH1004|PROTEIN

MVSERSGSRNIYKRFKGRGRKGEEGKELGKATLLEFGSESSSASLDSQPSTPHALTPLLVLPWLKSSPISNATKMDYNFTMQLLAIILSQLTLKRKCLKWPKHLGNLPRSISVFSRFHFPATTSTRHHRISGDQSVYSFAGTVRVCLVQSDEKLPPTPSSSFIWSPTVLLLDAANRPLSDLHLLGCCTQSSDATSSSFLCRCVPPATTSSFLPFLTALLPFCLLIHLQLFEHSLSYDDFVAFTFYGVIILPIFLTMHIFD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021278`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021278

Location Chr04:126455832-126457786 (-)

Description Similar to RPL21: 50S ribosomal protein L21, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g35680`	This protein binds to 23S ribosomal RNA in the presence of protein L20.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021278 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006412 translation Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0010027 thylakoid membrane organization Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005840 ribosome Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:1990904 ribonucleoprotein complex Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G35680

cbe:Cbei_0508

dth:DICTH_1177

dtu:Dtur_1281

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.440

Rank 1 · LXL04_021278 · OH-1004

Cytoplasm0.366

Rank 2 · LXL04_021278 · OH-1004

Plastid0.092

Rank 3 · LXL04_021278 · OH-1004

Mitochondrion0.088

Rank 4 · LXL04_021278 · OH-1004

Cell membrane0.079

Rank 5 · LXL04_021278 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00829.27Ribosomal_L21p263-360 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021278	`PF00829.27`	Ribosomal_L21p	263	360	6.1e-28	97.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P51412`	Arabidopsis thaliana	Large ribosomal subunit protein bL21c	78.947%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card