LXL04_021215 | RubberDandelionOmics

Gene overview

LXL04_021215

Reference: OH-1004 Chr: Chr04 Coordinates: 124752550-124754577 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1005 bp · LXL04_021215|LXL04_021215|OH1004|cDNA

ATGACACGAAAGCCAACAAGAAGATCCCATTTACGAAAGCCCCAACCTGCCTTCTCACGTTTAGGTCGTTCCATGGCCTTAGTTACCTCAGCTCGAAGGGCCAAGCAGCAAAATGACATGAATACCCCCAACTCCACAGGCATGGTCTCTTTTCCCCAAGGGCAAAATGGTAGCAAAAAGGAGAAACATGATACCATAGAAGCAAAGACACAAGTGtcatgttcttcttcttctgaaaatgaagaagatgattttgagGG...

CDS

Download CDS FASTA

1005 bp · LXL04_021215|LXL04_021215|OH1004|CDS

ATGACACGAAAGCCAACAAGAAGATCCCATTTACGAAAGCCCCAACCTGCCTTCTCACGTTTAGGTCGTTCCATGGCCTTAGTTACCTCAGCTCGAAGGGCCAAGCAGCAAAATGACATGAATACCCCCAACTCCACAGGCATGGTCTCTTTTCCCCAAGGGCAAAATGGTAGCAAAAAGGAGAAACATGATACCATAGAAGCAAAGACACAAGTGTCATGTTCTTCTTCTTCTGAAAATGAAGAAGATGATTTTGAGGG...

Protein

Download Protein FASTA

334 aa · LXL04_021215|LXL04_021215|OH1004|PROTEIN

MTRKPTRRSHLRKPQPAFSRLGRSMALVTSARRAKQQNDMNTPNSTGMVSFPQGQNGSKKEKHDTIEAKTQVSCSSSSENEEDDFEGVVQADFAFFDPKPDDFHGIKVLLQTFLDNKEWELTSFVDLILQQTTVGTVVKIEEDEDNSVYAFVSALNLQRYKESKCMMELKDFLMSMCQEKEIKEKLSSYLGEKAADVGLLISQRVVNLPPQLLPPLYDGLFDEISWATEDEPTKELRQSFAFKYYLLVSKIYKLKNVDQK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021215`
TK1151 ID	TkA05G367200
OH-1004 ID	LXL04_021215
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	94.100
Protein coverage (%)	TK1151 100.000 / OH-1004 50.599 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021215

Location Chr04:124752550-124754577 (+)

Description Similar to At2g44510: Protein BCCIP homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g44510`	Protein BCCIP homolog.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021215 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000055 ribosomal large subunit export from nucleus Biological Process

GO:0006611 protein export from nucleus Biological Process

GO:0015031 protein transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0030674 protein-macromolecule adaptor activity Molecular Function

GO:0044183 protein folding chaperone Molecular Function

KEGG gene cross-reference

afm:AFUA_5G13120

aor:AO090120000437

ath:AT2G44510

spo:2538703

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.734

Rank 1 · LXL04_021215 · OH-1004

Cytoplasm0.313

Rank 2 · LXL04_021215 · OH-1004

Mitochondrion0.057

Rank 3 · LXL04_021215 · OH-1004

Cell membrane0.034

Rank 4 · LXL04_021215 · OH-1004

Endoplasmic reticulum0.023

Rank 5 · LXL04_021215 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13862.12BCCIP89-282 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021215	`PF13862.12`	BCCIP	89	282	5.5e-61	206.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O64885`	Arabidopsis thaliana	Protein BCCIP homolog	54.252%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card