LXL04_021124 | RubberDandelionOmics

Gene overview

LXL04_021124

Reference: OH-1004 Chr: Chr04 Coordinates: 122099801-122104084 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

936 bp · LXL04_021124|LXL04_021124|OH1004|cDNA

ATGGCCAATTCGAAAAAAAACCCAATTCAAGATGCTATTTCCAGAATTCGCTTTGCCCCTTCTTCCAACAATCTCCTCATCTCTTCCTGGGATACTAATCTTAGATTGCACGATGTGGATAGATCTAGGTTAACTTTTGAAGCTTCCGGGGAAGCTGCGCTTCTGGATTGCTGTTTCCAAGGAGAATCAGCTGACTTCAGTGCCACTTCTGATTGCTCCATAACTGGTTATGAATCCAGCATTGATTTGTTTGACCTTCA...

CDS

Download CDS FASTA

936 bp · LXL04_021124|LXL04_021124|OH1004|CDS

ATGGCCAATTCGAAAAAAAACCCAATTCAAGATGCTATTTCCAGAATTCGCTTTGCCCCTTCTTCCAACAATCTCCTCATCTCTTCCTGGGATACTAATCTTAGATTGCACGATGTGGATAGATCTAGGTTAACTTTTGAAGCTTCCGGGGAAGCTGCGCTTCTGGATTGCTGTTTCCAAGGAGAATCAGCTGACTTCAGTGCCACTTCTGATTGCTCCATAACTGGTTATGAATCCAGCATTGATTTGTTTGACCTTCA...

Protein

Download Protein FASTA

311 aa · LXL04_021124|LXL04_021124|OH1004|PROTEIN

MANSKKNPIQDAISRIRFAPSSNNLLISSWDTNLRLHDVDRSRLTFEASGEAALLDCCFQGESADFSATSDCSITGYESSIDLFDLQGQSSSFSVESSESRTCISLYTFRCQPKSKEKMDYFAAVNDIVFSPSSSGCKGVEAARETTERGRQRWRNGFLSGWSDCWRKTWTPENGYDRRVEVKKTLWKKSRTHQKNRTKPVEKEAGSDRRSGSDPGRIGNFVDFVMGDNKGYVTIWNAQSKRRVCEMPKFENSIASLSYN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021124`
TK1151 ID	TkA07G428320
OH-1004 ID	LXL04_021124
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	63.500
Protein coverage (%)	TK1151 38.346 / OH-1004 16.720 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021124

Location Chr04:122099801-122104084 (+)

Description Similar to BUB3.3: Mitotic checkpoint protein BUB3.3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g69400`	Has a dual function in spindle-assembly checkpoint signaling and in promoting the establishment of correct kinetochore-microtubule (K-MT) attachments.	No verified direct reference in this release
`At3g19590`	Has a dual function in spindle-assembly checkpoint signaling and in promoting the establishment of correct kinetochore-microtubule (K-MT) attachments.	The Arabidopsis checkpoint protein Bub3.1 is essential for gametophyte development.2008 · DOI: 10.2741/3076 Spindle assembly checkpoint protein dynamics reveal conserved and unsuspected roles in plant cell division.2009 · DOI: 10.1371/journal.pone.0006757
`At1g49910`	Has a dual function in spindle-assembly checkpoint signaling and in promoting the establishment of correct kinetochore-microtubule (K-MT) attachments.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021124 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007059 chromosome segregation Biological Process

GO:0007094 mitotic spindle assembly checkpoint signaling Biological Process

GO:0008608 attachment of spindle microtubules to kinetochore Biological Process

GO:0034501 protein localization to kinetochore Biological Process

GO:0051301 cell division Biological Process

GO:0051321 meiotic cell cycle Biological Process

GO:0051983 regulation of chromosome segregation Biological Process

GO:0000776 kinetochore Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005819 spindle Cellular Component

GO:0005828 kinetochore microtubule Cellular Component

KEGG gene cross-reference

ath:AT1G49910

ath:AT1G69400

ath:AT3G19590

mmu:12237

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.749

Rank 1 · LXL04_021124 · OH-1004

Cytoplasm0.246

Rank 2 · LXL04_021124 · OH-1004

Cell membrane0.044

Rank 3 · LXL04_021124 · OH-1004

Mitochondrion0.040

Rank 4 · LXL04_021124 · OH-1004

Endoplasmic reticulum0.034

Rank 5 · LXL04_021124 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24796.2WDR55224-280 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021124	`PF24796.2`	WDR55	224	280	1.1e-07	31.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4I241`	Arabidopsis thaliana	Mitotic checkpoint protein BUB3.3	49.438%	Swiss-Prot	weak database homology
`Q9LJN8`	Arabidopsis thaliana	Mitotic checkpoint protein BUB3.1	25.413%	Swiss-Prot	weak database homology
`Q9C701`	Arabidopsis thaliana	Mitotic checkpoint protein BUB3.2	41.176%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card