Gene Card
Gene overview
cDNA / CDS / Protein Sequences
344 bp · LXL04_021112|LXL04_021112|OH1004|cDNA
ATGCCGCCACTTTCTAAGTTAACTACTTACTCTTCAATTTCTCAGCTTAAGCCACAAAAACGATGGATTACATCAAACACCTTGAACCAAGGGATTATAAGCCATCGTAGAATAACAATCTATAATCTTCGTATGTCATCACCATCAAGAAAACTTATCATGAGGGCAATTGACGATTTCAACTGTTACAGTTTTGAGGCAAGAAAATTAGAAGAAGCCAAGTGTGTGCATAAAGATCATGTGTATGATGCTACGGAAAT...
327 bp · LXL04_021112|LXL04_021112|OH1004|CDS
ATGCCGCCACTTTCTAAGTTAACTACTTACTCTTCAATTTCTCAGCTTAAGCCACAAAAACGATGGATTACATCAAACACCTTGAACCAAGGGATTATAAGCCATCGTAGAATAACAATCTATAATCTTCGTATGTCATCACCATCAAGAAAACTTATCATGAGGGCAATTGACGATTTCAACTGTTACAGTTTTGAGGCAAGAAAATTAGAAGAAGCCAAGTGTGTGCATAAAGATCATGTGTATGATGCTACGGAAAT...
Protein
Download Protein FASTA108 aa · LXL04_021112|LXL04_021112|OH1004|PROTEIN
MPPLSKLTTYSSISQLKPQKRWITSNTLNQGIISHRRITIYNLRMSSPSRKLIMRAIDDFNCYSFEARKLEEAKCVHKDHVYDATEIDYSPTCRKFLTGSYDRTARSE
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_021112 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_021112 |
|---|---|
| Location | Chr04:121882617-121884491 (-) |
| Description | Similar to wdsof1: DDB1- and CUL4-associated factor 13 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000462 maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0006364 rRNA processing Biological Process GO:0007056 spindle assembly involved in female meiosis Biological Process GO:0016567 protein ubiquitination Biological Process GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process GO:0044725 epigenetic programming in the zygotic pronuclei Biological Process GO:0051898 negative regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005730 nucleolus Cellular Component GO:0005813 centrosome Cellular Component GO:0005829 cytosol Cellular Component |
| KEGG gene cross-reference | ddi:DDB_G0276815 dre:393097 gga:420263 mmu:223499 spo:2540796 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
No result was found for this query.
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.