LXL04_020762 | RubberDandelionOmics

Gene overview

LXL04_020762

Reference: OH-1004 Chr: Chr04 Coordinates: 108083503-108088258 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1224 bp · LXL04_020762|LXL04_020762|OH1004|cDNA

ATGAAATATTCCCATCGCTATCCCAAAAGCCACGAAAACGGAGAAAGATTCTCATTGAAAAGAAACCACCATGGTCGacctttccttctttcttcTGTTAACTATTGCCCTTTATTTCAATCATCCAATCTTTCTAATGAACCCCCAAAATGGGTATCTCTACAAAAGCCCCACTTCGAATTGGGTCTCCATCAAAATCCATCAAGATCAAGAAAACCAAAAGGAAAGCTGGAGTGGACCAAAGAGAACCCATTAGTGAA...

CDS

Download CDS FASTA

1224 bp · LXL04_020762|LXL04_020762|OH1004|CDS

ATGAAATATTCCCATCGCTATCCCAAAAGCCACGAAAACGGAGAAAGATTCTCATTGAAAAGAAACCACCATGGTCGACCTTTCCTTCTTTCTTCTGTTAACTATTGCCCTTTATTTCAATCATCCAATCTTTCTAATGAACCCCCAAAATGGGTATCTCTACAAAAGCCCCACTTCGAATTGGGTCTCCATCAAAATCCATCAAGATCAAGAAAACCAAAAGGAAAGCTGGAGTGGACCAAAGAGAACCCATTAGTGAA...

Protein

Download Protein FASTA

407 aa · LXL04_020762|LXL04_020762|OH1004|PROTEIN

MKYSHRYPKSHENGERFSLKRNHHGRPFLLSSVNYCPLFQSSNLSNEPPKWVSLQKPHFELGLHQNPSRSRKPKGKLEWTKENPLVKRIRLWRWFGTLNQMPMNDYVFNDYKSLPRVLLFEPGGSSAEVLLYGGKVVSWKNSQGEELLFMSRNAGGRFPKGGISLCFPQVANTGMMKEICWSKKNAKSFDNIPLRLTPTGNPSSVDLTLKTTANDSNTWPRSFEIRLRVSLGPDKMTILTHIKNTDTTPFSFTFALQNYL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_020762`
TK1151 ID	TkA05G303310
OH-1004 ID	LXL04_020762
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_020762

Location Chr04:108083503-108088258 (+)

Description Similar to Putative glucose-6-phosphate 1-epimerase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g55370`	Required for both formation and activity of the chloroplast NAD(P)H dehydrogenase (NDH) complex of the photosynthetic electron transport chain.	A novel nuclear-encoded protein, NDH-dependent cyclic electron flow 5, is essential for the accumulation of chloroplast NAD(P)H dehydrogenase complexes.2009 · DOI: 10.1093/pcp/pcn205

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020762 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0006974 DNA damage response Biological Process

GO:0009773 photosynthetic electron transport in photosystem I Biological Process

GO:0010628 positive regulation of gene expression Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0030246 carbohydrate binding Molecular Function

GO:0047938 glucose-6-phosphate 1-epimerase activity Molecular Function

KEGG gene cross-reference

ath:AT1G55370

ecj:JW1769

eco:b1780

ecoc:C3026_10155

sce:YMR099C

stm:STM1289

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.582

Rank 1 · LXL04_020762 · OH-1004

Cytoplasm0.219

Rank 2 · LXL04_020762 · OH-1004

Mitochondrion0.180

Rank 3 · LXL04_020762 · OH-1004

Nucleus0.104

Rank 4 · LXL04_020762 · OH-1004

Peroxisome0.064

Rank 5 · LXL04_020762 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01263.27Aldose_epim120-384 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_020762	`PF01263.27`	Aldose_epim	120	384	1.1e-34	120.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C503`	Arabidopsis thaliana	Protein NDH-DEPENDENT CYCLIC ELECTRON FLOW 5	22.892%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card