LXL04_020684 | RubberDandelionOmics

Gene overview

LXL04_020684

Reference: OH-1004 Chr: Chr04 Coordinates: 104833881-104836925 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1881 bp · LXL04_020684|LXL04_020684|OH1004|cDNA

ATGGCGCCTTCATACTTCCCATTAAGGTGGGAAAGCACAGGTGATCAATGGTGGTATGCCTCTCCAATCGATTTAGCAGCTGCTAATGGTCACTACGATTTGGTCAGAGAGCTTCTTCATTTCGACACAAACCTCCTCATCAAATTAACCTCCCTCCGCCGCATACGGCGGCTGGAGACGGTATGGGACGATGAAGATCAATTCAACGATGTTGCAAAAAACAGATCAAAAGTGGCAAGAAAACTACTTCTCGAAAGCGA...

CDS

Download CDS FASTA

1881 bp · LXL04_020684|LXL04_020684|OH1004|CDS

ATGGCGCCTTCATACTTCCCATTAAGGTGGGAAAGCACAGGTGATCAATGGTGGTATGCCTCTCCAATCGATTTAGCAGCTGCTAATGGTCACTACGATTTGGTCAGAGAGCTTCTTCATTTCGACACAAACCTCCTCATCAAATTAACCTCCCTCCGCCGCATACGGCGGCTGGAGACGGTATGGGACGATGAAGATCAATTCAACGATGTTGCAAAAAACAGATCAAAAGTGGCAAGAAAACTACTTCTCGAAAGCGA...

Protein

Download Protein FASTA

626 aa · LXL04_020684|LXL04_020684|OH1004|PROTEIN

MAPSYFPLRWESTGDQWWYASPIDLAAANGHYDLVRELLHFDTNLLIKLTSLRRIRRLETVWDDEDQFNDVAKNRSKVARKLLLESEPRKGHGHNSLIRAGYGGWLLYTAASAGDVDFVKQLLKRDPLLVFGEGEYGVTDILYAAARGKNCEVFQVLFDFSLWSKGGEIGSVFKFEMMNRAVHAAARGGSLEILKELLEDCDDVLMYKDLQGSSLLHSACGRGQTEVVKYLLDSYDATGSTDTQGNTPLHIAAYNGHLKV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_020684`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_020684`
Location	Chr04:104833881-104836925 (-)
Description	Similar to Mib1: E3 ubiquitin-protein ligase MIB1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_020684` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006511 ubiquitin-dependent protein catabolic process Biological Process GO:0006897 endocytosis Biological Process GO:0007219 Notch signaling pathway Biological Process GO:0010803 regulation of tumor necrosis factor-mediated signaling pathway Biological Process GO:0016567 protein ubiquitination Biological Process GO:0045807 positive regulation of endocytosis Biological Process GO:0000139 Golgi membrane Cellular Component GO:0000151 ubiquitin ligase complex Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005769 early endosome Cellular Component GO:0005813 centrosome Cellular Component GO:0005829 cytosol Cellular Component
KEGG gene cross-reference	hsa:142678 hsa:57534 mmu:225164 mmu:76580 xla:444232 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.586

Rank 1 · LXL04_020684 · OH-1004

Nucleus0.258

Rank 2 · LXL04_020684 · OH-1004

Cytoplasm0.206

Rank 3 · LXL04_020684 · OH-1004

Endoplasmic reticulum0.059

Rank 4 · LXL04_020684 · OH-1004

Plastid0.057

Rank 5 · LXL04_020684 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13637.13Ank_4182-232 aa

PF12796.14Ank_2183-266 aa

PF13857.13Ank_5239-284 aa

PF13637.13Ank_4241-265 aa

PF00023.37Ank244-266 aa

PF13606.13Ank_3245-267 aa

PF12796.14Ank_2304-366 aa

PF13857.13Ank_5320-368 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_020684	`PF13637.13`	Ank_4	182	232	3.4e-24	85.1
LXL04_020684	`PF12796.14`	Ank_2	183	266	1.8e-34	118.9
LXL04_020684	`PF13857.13`	Ank_5	239	284	2.3e-28	98.6
LXL04_020684	`PF13637.13`	Ank_4	241	265	3.4e-24	85.1
LXL04_020684	`PF00023.37`	Ank	244	266	1.7e-29	100.9
LXL04_020684	`PF13606.13`	Ank_3	245	267	1.9e-26	89.6
LXL04_020684	`PF12796.14`	Ank_2	304	366	1.8e-34	118.9
LXL04_020684	`PF13857.13`	Ank_5	320	368	2.3e-28	98.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card