LXL04_020131 | RubberDandelionOmics

Gene overview

LXL04_020131

Reference: OH-1004 Chr: Chr04 Coordinates: 52759570-52762645 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2175 bp · LXL04_020131|LXL04_020131|OH1004|cDNA

ATGGTTCTTGACACAAGTTCTGCTTGCACGGACCTCTCTACAATGGCGGCATCTTCTGCATGCATAGTAGGAAACGGTTTATCCACTCGCAAGCATTTCAACATCTCTCCTACCCTCCCATCTCTCGATAAATCCCCAAAAGTAAGAATCATAACCGCCTCTCTAGACAAAAAGCCACACGATCGAAGAGGCTTCCTCAAATTACTCCTCGGAAACGCCGGAATCGCAACTCCGGCCTTACTCACCACCGGAATCGCCAA...

CDS

Download CDS FASTA

2175 bp · LXL04_020131|LXL04_020131|OH1004|CDS

ATGGTTCTTGACACAAGTTCTGCTTGCACGGACCTCTCTACAATGGCGGCATCTTCTGCATGCATAGTAGGAAACGGTTTATCCACTCGCAAGCATTTCAACATCTCTCCTACCCTCCCATCTCTCGATAAATCCCCAAAAGTAAGAATCATAACCGCCTCTCTAGACAAAAAGCCACACGATCGAAGAGGCTTCCTCAAATTACTCCTCGGAAACGCCGGAATCGCAACTCCGGCCTTACTCACCACCGGAATCGCCAA...

Protein

Download Protein FASTA

724 aa · LXL04_020131|LXL04_020131|OH1004|PROTEIN

MVLDTSSACTDLSTMAASSACIVGNGLSTRKHFNISPTLPSLDKSPKVRIITASLDKKPHDRRGFLKLLLGNAGIATPALLTTGIANAADDQGVSNSRMSYSRFLEYLDKDRVNKVDLFENGTIAIVEAVSPELGNRVQRVRVQLPGLSQELLQKFREKNIDFAAHNAQEDSGSLIFNLIGNLAFPLILIGGLFLLSRRSPGGMGGPGGPGNPLAFGQSKAKFQMEPNTGVTFDDVAGVDEAKQDFQEVVEFLKKPERFT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_020131`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_020131

Location Chr04:52759570-52762645 (+)

Description Similar to FTSH2: ATP-dependent zinc metalloprotease FTSH 2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g30950`	Part of a complex that function as an ATP-dependent zinc metallopeptidase.	Mutations in the Arabidopsis VAR2 locus cause leaf variegation due to the loss of a chloroplast FtsH protease.2000 · DOI: 10.1046/j.1365-313x.2000.00738.x A critical role for the Var2 FtsH homologue of Arabidopsis thaliana in the photosystem II repair cycle in vivo.2002 · DOI: 10.1074/jbc.m105878200 Coordinated regulation and complex formation of yellow variegated1 and yellow variegated2, chloroplastic FtsH metalloproteases involved in the repair cycle of photosystem II in Arabidopsis thylakoid membranes.2003 · DOI: 10.1105/tpc.017319
`At1g06430`	Part of a complex that function as an ATP-dependent zinc metallopeptidase.	No verified direct reference in this release
`At5g15250`	Probable ATP-dependent zinc metallopeptidase.	AtFtsH6 is involved in the degradation of the light-harvesting complex II during high-light acclimation and senescence.2005 · DOI: 10.1073/pnas.0503472102

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0669400`	Probable ATP-dependent zinc metallopeptidase.	No verified direct reference in this release
`Os06g0229066`	Probable ATP-dependent zinc metallopeptidase.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020131 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0010027 thylakoid membrane organization Biological Process

GO:0010205 photoinhibition Biological Process

GO:0010206 photosystem II repair Biological Process

GO:0010304 PSII associated light-harvesting complex II catabolic process Biological Process

GO:0030163 protein catabolic process Biological Process

GO:0048564 photosystem I assembly Biological Process

GO:0072593 reactive oxygen species metabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G06430

ath:AT2G30950

ath:AT5G15250

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.963

Rank 1 · LXL04_020131 · OH-1004

Mitochondrion0.053

Rank 2 · LXL04_020131 · OH-1004

Nucleus0.019

Rank 3 · LXL04_020131 · OH-1004

Cytoplasm0.018

Rank 4 · LXL04_020131 · OH-1004

Cell membrane0.010

Rank 5 · LXL04_020131 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06480.21FtsH_ext90-165 aa

PF00004.36AAA270-402 aa

PF17862.8AAA_lid_3425-468 aa

PF01434.25Peptidase_M41484-673 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_020131	`PF06480.21`	FtsH_ext	90	165	4.6e-07	30.7
LXL04_020131	`PF00004.36`	AAA	270	402	6.1e-47	160.1
LXL04_020131	`PF17862.8`	AAA_lid_3	425	468	1.6e-13	50.6
LXL04_020131	`PF01434.25`	Peptidase_M41	484	673	1e-66	225.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80860`	Arabidopsis thaliana	ATP-dependent zinc metalloprotease FTSH 2, chloroplastic	87.701%	Swiss-Prot	strong database homology
`Q8W585`	Arabidopsis thaliana	ATP-dependent zinc metalloprotease FTSH 8, chloroplastic	87.445%	Swiss-Prot	strong database homology
`Q1PDW5`	Arabidopsis thaliana	ATP-dependent zinc metalloprotease FTSH 6, chloroplastic	67.270%	Swiss-Prot	strong database homology
`Q655S1`	Oryza sativa subsp. japonica	ATP-dependent zinc metalloprotease FTSH 2, chloroplastic	89.231%	Swiss-Prot	strong database homology
`Q67WJ2`	Oryza sativa subsp. japonica	ATP-dependent zinc metalloprotease FTSH 6, chloroplastic	68.812%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card