LXL04_020017 | RubberDandelionOmics

Gene overview

LXL04_020017

Reference: OH-1004 Chr: Chr04 Coordinates: 47576736-47579729 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1854 bp · LXL04_020017|LXL04_020017|OH1004|cDNA

ATGGCTGGAGCTCCACCGCCACCATGGAAACCCCTACACATACTCTTCTCCTTCCTTTACATCACCATGGTTATGTTTTCCGGTGCAAGTGCACAAGAGTTTTTAACATCCGAGCGAACCACATTGCTTAACCTCAAGCAAAAATGGGGGAATCCACCGTCACTGAGGAACTGGAACGCATCTTCATCACCGTGTAATTGGCTAGAAGTTTCATGCGATGACGGCTCTGTTACTCTAATTGAAATTGATATTGCAAGGAA...

CDS

Download CDS FASTA

1854 bp · LXL04_020017|LXL04_020017|OH1004|CDS

ATGGCTGGAGCTCCACCGCCACCATGGAAACCCCTACACATACTCTTCTCCTTCCTTTACATCACCATGGTTATGTTTTCCGGTGCAAGTGCACAAGAGTTTTTAACATCCGAGCGAACCACATTGCTTAACCTCAAGCAAAAATGGGGGAATCCACCGTCACTGAGGAACTGGAACGCATCTTCATCACCGTGTAATTGGCTAGAAGTTTCATGCGATGACGGCTCTGTTACTCTAATTGAAATTGATATTGCAAGGAA...

Protein

Download Protein FASTA

617 aa · LXL04_020017|LXL04_020017|OH1004|PROTEIN

MAGAPPPPWKPLHILFSFLYITMVMFSGASAQEFLTSERTTLLNLKQKWGNPPSLRNWNASSSPCNWLEVSCDDGSVTLIEIDIARNEFTGKLPNDIDRLSILLSIDLGDNNFTGDIPPTIGNVSTLMQLMLNDNSVSGSIPSEIGNLSNLLILELCSNLFAAAEIPPEFMKLSNLTKFYMAQTNLIGKIQESLVNLFSLESLDLSSNNLEGEIPSGLFLMENLGSLSLNKNMLSGKIPPVIESLILTQIDVSMNKLTGS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_020017`
TK1151 ID	TkA05G117110
OH-1004 ID	LXL04_020017
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	72.300
Protein coverage (%)	TK1151 99.250 / OH-1004 79.741 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_020017

Location Chr04:47576736-47579729 (-)

Description Similar to RLP52: Receptor-like protein 52

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g25910`	Required for defense against powdery mildew pathogen.	No verified direct reference in this release
`At1g28440`	Receptor-like protein kinase HSL1.	No verified direct reference in this release
`At5g65710`	Receptor-like serine/threonine-kinase acting on substrates that controls floral organ abscission.	No verified direct reference in this release
`At1g72180`	Receptor kinase involved in the perception of C-terminally encoded plant signaling peptide (CEP) and subsequent regulation of root and shoot development.	No verified direct reference in this release
`At2g25790`	Receptor with a serine/threonine-protein kinase activity (By similarity).	A novel pollen-pistil interaction conferring high-temperature tolerance during reproduction via CLE45 signaling.2013 · DOI: 10.1016/j.cub.2013.06.060 Arabidopsis MAKR5 is a positive effector of BAM3-dependent CLE45 signaling.2016 · DOI: 10.15252/embr.201642450

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020017 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0007165 signal transduction Biological Process

GO:0010200 response to chitin Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0051707 response to other organism Biological Process

GO:0140547 acquisition of seed longevity Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G28440

ath:AT5G25910

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.824

Rank 1 · LXL04_020017 · OH-1004

Endoplasmic reticulum0.099

Rank 2 · LXL04_020017 · OH-1004

Cytoplasm0.067

Rank 3 · LXL04_020017 · OH-1004

Nucleus0.052

Rank 4 · LXL04_020017 · OH-1004

Extracellular0.032

Rank 5 · LXL04_020017 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263.18LRRNT_236-73 aa

PF23598.2LRR_1491-277 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_020017	`PF08263.18`	LRRNT_2	36	73	8.4e-08	33.1
LXL04_020017	`PF23598.2`	LRR_14	91	277	3.7e-17	62.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7FZR1`	Arabidopsis thaliana	Receptor-like protein 52	36.914%	Swiss-Prot	moderate database homology
`Q9SGP2`	Arabidopsis thaliana	Receptor-like protein kinase HSL1	36.772%	Swiss-Prot	moderate database homology
`C0LGX3`	Arabidopsis thaliana	LRR receptor-like serine/threonine-protein kinase HSL2	30.843%	Swiss-Prot	moderate database homology
`Q9C7T7`	Arabidopsis thaliana	Receptor protein-tyrosine kinase CEPR2	32.479%	Swiss-Prot	moderate database homology
`O82318`	Arabidopsis thaliana	Leucine-rich repeat receptor-like serine/threonine-protein kinase SKM1	36.856%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card