LXL04_019831 | RubberDandelionOmics

Gene overview

LXL04_019831

Reference: OH-1004 Chr: Chr04 Coordinates: 41265734-41269760 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1293 bp · LXL04_019831|LXL04_019831|OH1004|cDNA

ATGTTCCATTCAAAGAAAGCAGCTGGCGCTTCCACCACTACGATGAATTCACTTCACCATaatcatcatcaccatcatgAAAGGTCCAACATGTGTGGCGTTGGCGCTAATAACCATAGTACCGCTGGTGCTGGTACCATACAAGGTGACTCGGGACTTGTGCTTACCACAGATCCCAAACCACGACTCAGGTGGACAGTGGAGCTCCATGAGCGCTTTGTTGATGCTGTCGCTCAGCTTGGAGGCCCTGACAAGGCTAC...

CDS

Download CDS FASTA

1293 bp · LXL04_019831|LXL04_019831|OH1004|CDS

ATGTTCCATTCAAAGAAAGCAGCTGGCGCTTCCACCACTACGATGAATTCACTTCACCATAATCATCATCACCATCATGAAAGGTCCAACATGTGTGGCGTTGGCGCTAATAACCATAGTACCGCTGGTGCTGGTACCATACAAGGTGACTCGGGACTTGTGCTTACCACAGATCCCAAACCACGACTCAGGTGGACAGTGGAGCTCCATGAGCGCTTTGTTGATGCTGTCGCTCAGCTTGGAGGCCCTGACAAGGCTAC...

Protein

Download Protein FASTA

430 aa · LXL04_019831|LXL04_019831|OH1004|PROTEIN

MFHSKKAAGASTTTMNSLHHNHHHHHERSNMCGVGANNHSTAGAGTIQGDSGLVLTTDPKPRLRWTVELHERFVDAVAQLGGPDKATPKTIMRVMGVKGLTLYHLKSHLQKFRLGKQPHKEFNDHSMKDSERASALDLQRNSNASSSGMMGRSMNEMQIEVQRRLHEQLEVQRHLQLRIEAQGKYMQTILEKACQTLAGDQSMAAAGYNNGNKVVGGSGGMGMNMNMSMSMNISASSSSTSHLDQAARGHRAGLMLLPGD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019831`
TK1151 ID	TkA05G094930
OH-1004 ID	LXL04_019831
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	98.300
Protein coverage (%)	TK1151 98.377 / OH-1004 70.465 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019831

Location Chr04:41265734-41269760 (-)

Description Similar to IPN2: Myb family transcription factor IPN2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g79430`	Transcription factor required for phloem identity.	No verified direct reference in this release
`At3g12730`	Myb family transcription factor PHL12.	No verified direct reference in this release
`At4g13640`	Transcriptional activator.	Arabidopsis PHL2 and PHR1 Act Redundantly as the Key Components of the Central Regulatory System Controlling Transcriptional Responses to Phosphate Starvation.2016 · DOI: 10.1104/pp.15.01336
`At3g24120`	Transcriptional activator.	Arabidopsis PHL2 and PHR1 Act Redundantly as the Key Components of the Central Regulatory System Controlling Transcriptional Responses to Phosphate Starvation.2016 · DOI: 10.1104/pp.15.01336

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019831 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009567 double fertilization forming a zygote and endosperm Biological Process

GO:0009877 nodulation Biological Process

GO:0009908 flower development Biological Process

GO:0010088 phloem development Biological Process

GO:0010089 xylem development Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0010628 positive regulation of gene expression Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G79430

ath:AT3G12730

ath:AT3G24120

ath:AT4G13640

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.977

Rank 1 · LXL04_019831 · OH-1004

Cytoplasm0.079

Rank 2 · LXL04_019831 · OH-1004

Cell membrane0.024

Rank 3 · LXL04_019831 · OH-1004

Endoplasmic reticulum0.016

Rank 4 · LXL04_019831 · OH-1004

Plastid0.010

Rank 5 · LXL04_019831 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00249.38Myb_DNA-binding62-112 aa

PF14379.12Myb_CC_LHEQLE157-196 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019831	`PF00249.38`	Myb_DNA-binding	62	112	1.6e-08	35.2
LXL04_019831	`PF14379.12`	Myb_CC_LHEQLE	157	196	9.7e-22	77.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SAK5`	Arabidopsis thaliana	Myb family transcription factor APL	48.241%	Swiss-Prot	moderate database homology
`Q8VYI2`	Arabidopsis thaliana	Myb family transcription factor PHL12	71.333%	Swiss-Prot	weak database homology
`Q8LAJ7`	Arabidopsis thaliana	Protein PHR1-LIKE 3	66.467%	Swiss-Prot	weak database homology
`Q94A57`	Arabidopsis thaliana	Protein PHR1-LIKE 2	59.677%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card