LXL04_019591 | RubberDandelionOmics

Gene overview

LXL04_019591

Reference: OH-1004 Chr: Chr04 Coordinates: 34662444-34664050 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1286 bp · LXL04_019591|LXL04_019591|OH1004|cDNA

CCaaaaaaaataaacattttCAATTGTGGGATGGGATCATTAAGAGGTCAACTTATTCTCTTTCTCTTTCCTGCCTCCATTATTCGCCCGCCCTTTCAACTCGCAGATTGGTCAATCAAAACCCTAGTATCCTCTCTGTAGTTTTATTCTATCGGATCAAACAAGCAAATCTGCATCCGATGGCCAAACGAACTCTACCGATCCTCAAGCAGTTGCTGCACCGACAAGCCCCGCCTGTTTCGACTCCATCCCGATCTGTC...

CDS

Download CDS FASTA

1263 bp · LXL04_019591|LXL04_019591|OH1004|CDS

TTGTGGGATGGGATCATTAAGAGGTCAACTTATTCTCTTTCTCTTTCCTGCCTCCATTATTCGCCCGCCCTTTCAACTCGCAGATTGGTCAATCAAAACCCTAGTATCCTCTCTGTAGTTTTATTCTATCGGATCAAACAAGCAAATCTGCATCCGATGGCCAAACGAACTCTACCGATCCTCAAGCAGTTGCTGCACCGACAAGCCCCGCCTGTTTCGACTCCATCCCGATCTGTCACCTACATGCCCCGGCCCGGTGA...

Protein

Download Protein FASTA

420 aa · LXL04_019591|LXL04_019591|OH1004|PROTEIN

MWDGIIKRSTYSLSLSCLHYSPALSTRRLVNQNPSILSVVLFYRIKQANLHPMAKRTLPILKQLLHRQAPPVSTPSRSVTYMPRPGDGAPRTVTLIPGDGIGPLVTGAVEQVMDAMHAPIYFEKFDVHGDMKTIPAEVLESIKKNKVCLKGGLNTPMGGGVSSLNVQLRKELDLYASLVNCFNLPGLPTRHENVDIVVIRENTEGEYAGLEHEVVPGVVESLKVITKFCSERIAKYAFEYAYLNNRKTVTAVHKANIMKL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019591`
TK1151 ID	TkA05G065820
OH-1004 ID	LXL04_019591
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.800
Protein coverage (%)	TK1151 97.424 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019591

Location Chr04:34662444-34664050 (+)

Description Similar to IDH1: Isocitrate dehydrogenase [NAD] regulatory subunit 1, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g35260`	Performs an essential role in the oxidative function of the citric acid cycle.	No verified direct reference in this release
`At4g35650`	Performs an essential role in the oxidative function of the citric acid cycle.	No verified direct reference in this release
`At2g17130`	Performs an essential role in the oxidative function of the citric acid cycle.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019591 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006099 tricarboxylic acid cycle Biological Process

GO:0006102 isocitrate metabolic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0045335 phagocytic vesicle Cellular Component

GO:0000287 magnesium ion binding Molecular Function

GO:0003723 RNA binding Molecular Function

GO:0004449 isocitrate dehydrogenase (NAD+) activity Molecular Function

KEGG gene cross-reference

ath:AT2G17130

ath:AT4G35260

ath:AT4G35650

ddi:DDB_G0293872

spo:2541894

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.864

Rank 1 · LXL04_019591 · OH-1004

Cytoplasm0.110

Rank 2 · LXL04_019591 · OH-1004

Plastid0.060

Rank 3 · LXL04_019591 · OH-1004

Nucleus0.056

Rank 4 · LXL04_019591 · OH-1004

Cell membrane0.031

Rank 5 · LXL04_019591 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00180.26Iso_dh92-415 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019591	`PF00180.26`	Iso_dh	92	415	9.3e-80	269.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LFC0`	Arabidopsis thaliana	Isocitrate dehydrogenase [NAD] regulatory subunit 1, mitochondrial	86.685%	Swiss-Prot	strong database homology
`O81796`	Arabidopsis thaliana	Isocitrate dehydrogenase [NAD] regulatory subunit 3, mitochondrial	81.522%	Swiss-Prot	strong database homology
`P93032`	Arabidopsis thaliana	Isocitrate dehydrogenase [NAD] regulatory subunit 2, mitochondrial	82.065%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card