LXL04_019321 | RubberDandelionOmics

Gene overview

LXL04_019321

Reference: OH-1004 Chr: Chr04 Coordinates: 28813877-28814431 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

330 bp · LXL04_019321|LXL04_019321|OH1004|cDNA

ATGTTGCAATGGATGGCTAATCCCGATTACAACTCTGGTAACAATGATGGAATCCATATCGAGAACACACACGATGTGAAGATATATAACTCCCTTATATCCAATGGTGGTGATTGTGTGTCAATTGGGGCAAGTAGTTATAATGTAGGCATAAAGAACATAACATGCGGTCAAATCCATGGGATAAGTACAAATGGACATGTTTTTGGCCTCTGATGTTCTTttaggcatttcatcgaacagaTGAAGTGCAAACTCAT...

CDS

Download CDS FASTA

216 bp · LXL04_019321|LXL04_019321|OH1004|CDS

ATGTTGCAATGGATGGCTAATCCCGATTACAACTCTGGTAACAATGATGGAATCCATATCGAGAACACACACGATGTGAAGATATATAACTCCCTTATATCCAATGGTGGTGATTGTGTGTCAATTGGGGCAAGTAGTTATAATGTAGGCATAAAGAACATAACATGCGGTCAAATCCATGGGATAAGTACAAATGGACATGTTTTTGGCCTCTGA

Protein

Download Protein FASTA

71 aa · LXL04_019321|LXL04_019321|OH1004|PROTEIN

MLQWMANPDYNSGNNDGIHIENTHDVKIYNSLISNGGDCVSIGASSYNVGIKNITCGQIHGISTNGHVFGL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019321`
TK1151 ID	TkA05G042850
OH-1004 ID	LXL04_019321
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	97.000
Protein coverage (%)	TK1151 63.810 / OH-1004 94.366 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019321

Location Chr04:28813877-28814431 (+)

Description Similar to At2g43860: Probable polygalacturonase At2g43860

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g43860`	Probable polygalacturonase At2g43860.	No verified direct reference in this release
`At1g48100`	Polygalacturonase not involved in the final stages of pod shatter.	No verified direct reference in this release
`At2g41850`	Polygalacturonase involved in cell separation in the final stages of pod shatter, in anther dehiscence and in floral organ abscission.	Expression of polygalacturonases and evidence to support their role during cell separation processes in Arabidopsis thaliana.2007 · DOI: 10.1093/jxb/erm222 ARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE1 (ADPG1), ADPG2, and QUARTET2 are Polygalacturonases required for cell separation during reproductive development in Arabidopsis.2009 · DOI: 10.1105/tpc.108.063768

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019321 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0009830 cell wall modification involved in abscission Biological Process

GO:0009831 plant-type cell wall modification involved in multidimensional cell growth Biological Process

GO:0009835 fruit ripening Biological Process

GO:0009901 anther dehiscence Biological Process

GO:0010047 fruit dehiscence Biological Process

GO:0010227 floral organ abscission Biological Process

GO:0045490 pectin catabolic process Biological Process

GO:0071555 cell wall organization Biological Process

GO:0005576 extracellular region Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0048046 apoplast Cellular Component

KEGG gene cross-reference

ath:AT1G48100

ath:AT2G41850

ath:AT2G43860

sly:544051

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.989

Rank 1 · LXL04_019321 · OH-1004

Cytoplasm0.009

Rank 2 · LXL04_019321 · OH-1004

Cell membrane0.007

Rank 3 · LXL04_019321 · OH-1004

Endoplasmic reticulum0.003

Rank 4 · LXL04_019321 · OH-1004

Mitochondrion0.003

Rank 5 · LXL04_019321 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00295.24Glyco_hydro_2811-63 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019321	`PF00295.24`	Glyco_hydro_28	11	63	3.3e-12	46.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O22818`	Arabidopsis thaliana	Probable polygalacturonase At2g43860	58.182%	Swiss-Prot	strong database homology
`Q949Z1`	Arabidopsis thaliana	Polygalacturonase At1g48100	57.692%	Swiss-Prot	strong database homology
`Q8RY29`	Arabidopsis thaliana	Polygalacturonase ADPG2	52.830%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card