LXL04_019312 | RubberDandelionOmics

Gene overview

LXL04_019312

Reference: OH-1004 Chr: Chr04 Coordinates: 28681887-28690331 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

951 bp · LXL04_019312|LXL04_019312|OH1004|cDNA

ATGGCACCGGAAGCAGTAGACTTTGATGGATCATCGTCTTCATTGAAGAAGGTGTGTGTAATGGATGCTGGAGGGTCTTTAGGATCTTCACTTGTATATCGCCTCCTTCAAAGAGGCTACTTCGTTCATGCCGCCGTTCAAAGTCCTGTCGAGATTGAGTCTATGATAAGAAGAAATATAGACAACAAAAACTTGAGAGTATTTCACACAGACCCGTTGGATTATCACAGTATAGTGGAAGCTTTGGAAGGATGTTGCGG...

CDS

Download CDS FASTA

951 bp · LXL04_019312|LXL04_019312|OH1004|CDS

ATGGCACCGGAAGCAGTAGACTTTGATGGATCATCGTCTTCATTGAAGAAGGTGTGTGTAATGGATGCTGGAGGGTCTTTAGGATCTTCACTTGTATATCGCCTCCTTCAAAGAGGCTACTTCGTTCATGCCGCCGTTCAAAGTCCTGTCGAGATTGAGTCTATGATAAGAAGAAATATAGACAACAAAAACTTGAGAGTATTTCACACAGACCCGTTGGATTATCACAGTATAGTGGAAGCTTTGGAAGGATGTTGCGG...

Protein

Download Protein FASTA

316 aa · LXL04_019312|LXL04_019312|OH1004|PROTEIN

MAPEAVDFDGSSSSLKKVCVMDAGGSLGSSLVYRLLQRGYFVHAAVQSPVEIESMIRRNIDNKNLRVFHTDPLDYHSIVEALEGCCGLFYSFEPPFDQLSYDELMAEVEVRAAHNVLEACAQTDTIDKVVFTSSATAVIWRDPNDSTPSLGDIDERNWSDVNFCKKFKLWHGLSKALTEKTAWALAMDRGVNMVSINAGLLLSPDLKVTHPYLKGAAEMYKDGIFVTVDLKFLVDSHICVFEESSAYGRYLCFNHVINSN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019312`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019312

Location Chr04:28681887-28690331 (-)

Description Similar to SNL6: Cinnamoyl-CoA reductase-like SNL6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g35420`	Involved in the biosynthesis of hydroxylated tetraketide compounds that serve as sporopollenin precursors (the main constituents of exine).	An anther-specific dihydroflavonol 4-reductase-like gene (DRL1) is essential for male fertility in Arabidopsis.2009 · DOI: 10.1111/j.1469-8137.2008.02692.x Analysis of TETRAKETIDE α-PYRONE REDUCTASE function in Arabidopsis thaliana reveals a previously unknown, but conserved, biochemical pathway in sporopollenin monomer biosynthesis.2010 · DOI: 10.1105/tpc.110.080036

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0639200`	Involved in defense response.	Rice Snl6, a cinnamoyl-CoA reductase-like gene family member, is required for NH1-mediated immunity to Xanthomonas oryzae pv. oryzae.2010 · DOI: 10.1371/journal.pgen.1001123

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019312 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006694 steroid biosynthetic process Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009555 pollen development Biological Process

GO:0009699 phenylpropanoid biosynthetic process Biological Process

GO:0009809 lignin biosynthetic process Biological Process

GO:0010584 pollen exine formation Biological Process

GO:0010597 green leaf volatile biosynthetic process Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0048316 seed development Biological Process

GO:0080110 sporopollenin biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT4G35420

dosa:Os01g0639200

mtr:25487973

osa:4326581

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.512

Rank 1 · LXL04_019312 · OH-1004

Nucleus0.317

Rank 2 · LXL04_019312 · OH-1004

Plastid0.116

Rank 3 · LXL04_019312 · OH-1004

Cell membrane0.090

Rank 4 · LXL04_019312 · OH-1004

Lysosome / Vacuole0.070

Rank 5 · LXL04_019312 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05368.20NmrA16-134 aa

PF01073.263Beta_HSD20-155 aa

PF13460.13NAD_binding_1023-137 aa

PF01370.28Epimerase23-205 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019312	`PF05368.20`	NmrA	16	134	8.5e-07	29.6
LXL04_019312	`PF01073.26`	3Beta_HSD	20	155	9e-08	32.2
LXL04_019312	`PF13460.13`	NAD_binding_10	23	137	1.3e-06	29.2
LXL04_019312	`PF01370.28`	Epimerase	23	205	1.7e-06	28.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q500U8`	Arabidopsis thaliana	Tetraketide alpha-pyrone reductase 1	32.566%	Swiss-Prot	moderate database homology
`Q0JKZ0`	Oryza sativa subsp. japonica	Cinnamoyl-CoA reductase-like SNL6	31.715%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card