LXL04_019296 | RubberDandelionOmics

Gene overview

LXL04_019296

Reference: OH-1004 Chr: Chr04 Coordinates: 28344480-28345250 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

771 bp · LXL04_019296|LXL04_019296|OH1004|cDNA

ATGGGGAAGCACAAGCTTAGATTGGCACATATGATACCAAATGCTTGGTTTTACAGGCTTCAAGATATGACCACTAAACCACTTCCATCTGCTTACTCTTCTTCAACTTCAAAGCACCACAACCACCCAAGAAACTCTATCTCCTACACCCCTAAAGTTTACACTACAAAACAACCACTCTACACTCAACCCACTGAGCCAACGGATCATACCCATCAAGATTCCTTTCTTTCACCTAGTAGCTCTGGTTATAAGTACCC...

CDS

Download CDS FASTA

771 bp · LXL04_019296|LXL04_019296|OH1004|CDS

ATGGGGAAGCACAAGCTTAGATTGGCACATATGATACCAAATGCTTGGTTTTACAGGCTTCAAGATATGACCACTAAACCACTTCCATCTGCTTACTCTTCTTCAACTTCAAAGCACCACAACCACCCAAGAAACTCTATCTCCTACACCCCTAAAGTTTACACTACAAAACAACCACTCTACACTCAACCCACTGAGCCAACGGATCATACCCATCAAGATTCCTTTCTTTCACCTAGTAGCTCTGGTTATAAGTACCC...

Protein

Download Protein FASTA

256 aa · LXL04_019296|LXL04_019296|OH1004|PROTEIN

MGKHKLRLAHMIPNAWFYRLQDMTTKPLPSAYSSSTSKHHNHPRNSISYTPKVYTTKQPLYTQPTEPTDHTHQDSFLSPSSSGYKYPSSESTRSLDTPPSTSCNSGLTASTNDLQKLPPIITKTTKTFMDVRSSMVDRNEETCSQTPGRQQVSGIKIRSNSSKTRVCKGMVDDNDDDKRQKKLSSRCCIVKSTFDPEKDLKESMVEMIMENNIRESKDLEQLLAYYLSLNPNEYHDMIVKACEEIWLSFNYSVQKF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019296`
TK1151 ID	TkA05G038880
OH-1004 ID	LXL04_019296
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019296

Location Chr04:28344480-28345250 (+)

Description Similar to OFP2: Transcription repressor OFP2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g30400`	Transcriptional repressor that regulates multiple aspects of plant growth and development through the regulation of BEL1-LIKE (BLH) and KNOX TALE (KNAT) homeodomain transcription factors.	No verified direct reference in this release
`At5g58360`	Transcriptional repressor that may regulate multiple aspects of plant growth and development through the regulation of BEL1-LIKE (BLH) and KNOX TALE (KNAT) homeodomain transcription factors.	No verified direct reference in this release
`At1g06920`	Transcriptional repressor that regulates multiple aspects of plant growth and development through the regulation of BEL1-LIKE (BLH) and KNOX TALE (KNAT) homeodomain transcription factors.	OVATE FAMILY PROTEIN4 (OFP4) interaction with KNAT7 regulates secondary cell wall formation in Arabidopsis thaliana.2011 · DOI: 10.1111/j.1365-313x.2011.04595.x Arabidopsis ovate family proteins, a novel transcriptional repressor family, control multiple aspects of plant growth and development.2011 · DOI: 10.1371/journal.pone.0023896
`At5g01840`	Transcriptional repressor that regulates multiple aspects of plant growth and development through the regulation of BEL1-LIKE (BLH) and KNOX TALE (KNAT) homeodomain transcription factors.	A central role of Arabidopsis thaliana ovate family proteins in networking and subcellular localization of 3-aa loop extension homeodomain proteins.2005 · DOI: 10.1073/pnas.0501181102 Arabidopsis Ovate Family Protein 1 is a transcriptional repressor that suppresses cell elongation.2007 · DOI: 10.1111/j.1365-313x.2007.03096.x OVATE FAMILY PROTEIN4 (OFP4) interaction with KNAT7 regulates secondary cell wall formation in Arabidopsis thaliana.2011 · DOI: 10.1111/j.1365-313x.2011.04595.x Arabidopsis ovate family proteins, a novel transcriptional repressor family, control multiple aspects of plant growth and development.2011 · DOI: 10.1371/journal.pone.0023896
`At4g18830`	Transcriptional repressor that regulates multiple aspects of plant growth and development through the regulation of BEL1-LIKE (BLH) and KNOX TALE (KNAT) homeodomain transcription factors.	A central role of Arabidopsis thaliana ovate family proteins in networking and subcellular localization of 3-aa loop extension homeodomain proteins.2005 · DOI: 10.1073/pnas.0501181102 Cell-fate switch of synergid to egg cell in Arabidopsis eostre mutant embryo sacs arises from misexpression of the BEL1-like homeodomain gene BLH1.2007 · DOI: 10.1105/tpc.107.054890 Arabidopsis ovate family proteins, a novel transcriptional repressor family, control multiple aspects of plant growth and development.2011 · DOI: 10.1371/journal.pone.0023896

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019296 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006281 DNA repair Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0009553 embryo sac development Biological Process

GO:0043622 cortical microtubule organization Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0051510 regulation of unidimensional cell growth Biological Process

GO:0071548 response to dexamethasone Biological Process

GO:2000652 regulation of secondary cell wall biogenesis Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005856 cytoskeleton Cellular Component

GO:0030863 cortical cytoskeleton Cellular Component

KEGG gene cross-reference

ath:AT1G06920

ath:AT2G30400

ath:AT4G18830

ath:AT5G01840

ath:AT5G58360

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.372

Rank 1 · LXL04_019296 · OH-1004

Nucleus0.370

Rank 2 · LXL04_019296 · OH-1004

Cytoplasm0.365

Rank 3 · LXL04_019296 · OH-1004

Endoplasmic reticulum0.066

Rank 4 · LXL04_019296 · OH-1004

Plastid0.040

Rank 5 · LXL04_019296 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13724.12DNA_binding_21-38 aa

PF04844.19Ovate195-248 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019296	`PF13724.12`	DNA_binding_2	1	38	1.9e-13	51.2
LXL04_019296	`PF04844.19`	Ovate	195	248	2.7e-20	72.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04351`	Arabidopsis thaliana	Transcription repressor OFP2	29.688%	Swiss-Prot	weak database homology
`Q9LVL4`	Arabidopsis thaliana	Transcription repressor OFP3	30.612%	Swiss-Prot	moderate database homology
`F4HNU8`	Arabidopsis thaliana	Transcription repressor OFP4	29.936%	Swiss-Prot	weak database homology
`Q9LZW2`	Arabidopsis thaliana	Transcription repressor OFP1	30.769%	Swiss-Prot	moderate database homology
`Q8VZN1`	Arabidopsis thaliana	Transcription repressor OFP5	46.875%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card