LXL04_019253 | RubberDandelionOmics

Gene overview

LXL04_019253

Reference: OH-1004 Chr: Chr04 Coordinates: 27380687-27383480 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

981 bp · LXL04_019253|LXL04_019253|OH1004|cDNA

AtggggaagaagaagaagagagtaTCATCAGACGTATGGTGTTATTATTGTGACAGAGAATTCGATGATGAGAAGATTTTGGTTCAGCACCAGAAGGCTAAGCATTTTAAGTGCCATGTCTGCCATAAGAAGCTTTCGACCGCTGGCGGTATGGCCATCCATGTCCTGCAGGTGCATAAAGAAACTGTTTCTAAGGTTCCCAATGCTAAAGAGGGCAGAGAATCAACAGATATTGAAATCTATGGCATGCAGGGTATCCC...

CDS

Download CDS FASTA

981 bp · LXL04_019253|LXL04_019253|OH1004|CDS

ATGGGGAAGAAGAAGAAGAGAGTATCATCAGACGTATGGTGTTATTATTGTGACAGAGAATTCGATGATGAGAAGATTTTGGTTCAGCACCAGAAGGCTAAGCATTTTAAGTGCCATGTCTGCCATAAGAAGCTTTCGACCGCTGGCGGTATGGCCATCCATGTCCTGCAGGTGCATAAAGAAACTGTTTCTAAGGTTCCCAATGCTAAAGAGGGCAGAGAATCAACAGATATTGAAATCTATGGCATGCAGGGTATCCC...

Protein

Download Protein FASTA

326 aa · LXL04_019253|LXL04_019253|OH1004|PROTEIN

MGKKKKRVSSDVWCYYCDREFDDEKILVQHQKAKHFKCHVCHKKLSTAGGMAIHVLQVHKETVSKVPNAKEGRESTDIEIYGMQGIPPDVLASHYGDEDNDNPTKVGKMEIPSSHIGMVPGSLGYPPSTMQSMYNPGIPRAGWPVPPPRPQQPWFQQNQVPPAPLGMVQLQQQPLFPVQTIRAPPGLQPSFPVAPPGIGSAPSVPLFPVVVGSSSNSNGMPSQTSPYSSATIQGGVAVSSHSYASGPNTGGPSIGPPPVI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019253`
TK1151 ID	TkA05G034160
OH-1004 ID	LXL04_019253
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019253

Location Chr04:27380687-27383480 (+)

Description Similar to SUF4: Protein SUPPRESSOR OF FRI 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g30970`	Sequence-specific DNA binding factor that recognizes the 5'- CCAAATTTTAAGTTT-3' sequence.	SUPPRESSOR OF FRI 4 encodes a nuclear-localized protein that is required for delayed flowering in winter-annual Arabidopsis.2006 · DOI: 10.1242/dev.02684 SUPPRESSOR OF FRIGIDA4, encoding a C2H2-Type zinc finger protein, represses flowering by transcriptional activation of Arabidopsis FLOWERING LOCUS C.2006 · DOI: 10.1105/tpc.106.045179 Resetting and regulation of Flowering Locus C expression during Arabidopsis reproductive development.2009 · DOI: 10.1111/j.1365-313x.2008.03776.x The FRIGIDA complex activates transcription of FLC, a strong flowering repressor in Arabidopsis, by recruiting chromatin modification factors.2011 · DOI: 10.1105/tpc.110.075911

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019253 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000070 mitotic sister chromatid segregation Biological Process

GO:0001578 microtubule bundle formation Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0007094 mitotic spindle assembly checkpoint signaling Biological Process

GO:0008608 attachment of spindle microtubules to kinetochore Biological Process

GO:0009908 flower development Biological Process

GO:0009910 negative regulation of flower development Biological Process

GO:0030154 cell differentiation Biological Process

GO:0046785 microtubule polymerization Biological Process

GO:0050821 protein stabilization Biological Process

GO:0051301 cell division Biological Process

GO:0051983 regulation of chromosome segregation Biological Process

KEGG gene cross-reference

ath:AT1G30970

hsa:7756

mmu:22680

xla:380016

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.953

Rank 1 · LXL04_019253 · OH-1004

Cytoplasm0.180

Rank 2 · LXL04_019253 · OH-1004

Cell membrane0.018

Rank 3 · LXL04_019253 · OH-1004

Mitochondrion0.014

Rank 4 · LXL04_019253 · OH-1004

Endoplasmic reticulum0.012

Rank 5 · LXL04_019253 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C5G0`	Arabidopsis thaliana	Protein SUPPRESSOR OF FRI 4	60.317%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card