LXL04_019249 | RubberDandelionOmics

Gene overview

LXL04_019249

Reference: OH-1004 Chr: Chr04 Coordinates: 27311679-27325696 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3896 bp · LXL04_019249|LXL04_019249|OH1004|cDNA

AATCCCCAAGTACAAGCATGCGTTCGATCACTGAGCTGCAACAGCCCCATATCAACATTCCGATTGCTTCACATAATCAATCAGCACCGCCATTGCCATTGAATCTACCTCGCTCCGATCTTCTTGTTGGAAGAAGAGAAGACTACAACGAAATTTGTGTTCCTTCGTATAAAGCAACAATCACCGGCGATTGGAAAGCTGCCAAAACCATCCTTGACAAGCGGCCGGAGCTTGTCCGGTTTAGCATCACCGAAAGTTAC...

CDS

Download CDS FASTA

3879 bp · LXL04_019249|LXL04_019249|OH1004|CDS

ATGCGTTCGATCACTGAGCTGCAACAGCCCCATATCAACATTCCGATTGCTTCACATAATCAATCAGCACCGCCATTGCCATTGAATCTACCTCGCTCCGATCTTCTTGTTGGAAGAAGAGAAGACTACAACGAAATTTGTGTTCCTTCGTATAAAGCAACAATCACCGGCGATTGGAAAGCTGCCAAAACCATCCTTGACAAGCGGCCGGAGCTTGTCCGGTTTAGCATCACCGAAAGTTACGACACGGTACTTCACAT...

Protein

Download Protein FASTA

1292 aa · LXL04_019249|LXL04_019249|OH1004|PROTEIN

MRSITELQQPHINIPIASHNQSAPPLPLNLPRSDLLVGRREDYNEICVPSYKATITGDWKAAKTILDKRPELVRFSITESYDTVLHIAVLGKSYWFVQYLVSLMEKEDLELQNQNGQTALCLAAMAGNVKIAMILVKKNNALLDIPDSRGMMPLYMAALFGKHDMVKYLYHNSQKMTGDFWTYHNRVCVLVKCVEANLFDVALQIVIDCPELAINGRVLGLLARKPYAFDATRTNIFWRLKSSFFAVCRLRVGNPDMESY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019249`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019249

Location Chr04:27311679-27325696 (+)

Description Similar to NPR4: Ankyrin repeat-containing protein NPR4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g12360`	Involved in salt stress tolerance.	ITN1, a novel gene encoding an ankyrin-repeat protein that affects the ABA-mediated production of reactive oxygen species and is involved in salt-stress tolerance in Arabidopsis thaliana.2008 · DOI: 10.1111/j.1365-313x.2008.03614.x
`At5g02620`	Ankyrin repeat-containing protein At5g02620.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0837000`	Involved in salt stress tolerance.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019249 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006929 substrate-dependent cell migration Biological Process

GO:0009651 response to salt stress Biological Process

GO:0048013 ephrin receptor signaling pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0046875 ephrin receptor binding Molecular Function

KEGG gene cross-reference

ath:AT3G12360

ath:AT5G02620

dosa:Os01g0837000

hsa:23294

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.784

Rank 1 · LXL04_019249 · OH-1004

Cytoplasm0.113

Rank 2 · LXL04_019249 · OH-1004

Endoplasmic reticulum0.093

Rank 3 · LXL04_019249 · OH-1004

Nucleus0.051

Rank 4 · LXL04_019249 · OH-1004

Lysosome / Vacuole0.042

Rank 5 · LXL04_019249 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12796.14Ank_285-174 aa

PF13637.13Ank_4120-169 aa

PF13962.12PGG394-425 aa

PF12796.14Ank_2538-630 aa

PF12796.14Ank_2587-664 aa

PF13637.13Ank_4613-661 aa

PF13962.12PGG984-1097 aa

PF10551.16MULE1182-1273 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019249	`PF12796.14`	Ank_2	85	174	1.2e-34	119.4
LXL04_019249	`PF13637.13`	Ank_4	120	169	1.7e-20	73.3
LXL04_019249	`PF13962.12`	PGG	394	425	1.3e-37	128.8
LXL04_019249	`PF12796.14`	Ank_2	538	630	1.2e-34	119.4
LXL04_019249	`PF12796.14`	Ank_2	587	664	1.2e-34	119.4
LXL04_019249	`PF13637.13`	Ank_4	613	661	1.7e-20	73.3
LXL04_019249	`PF13962.12`	PGG	984	1097	1.3e-37	128.8
LXL04_019249	`PF10551.16`	MULE	1182	1273	1.2e-07	32.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C7A2`	Arabidopsis thaliana	Ankyrin repeat-containing protein ITN1	21.351%	Swiss-Prot	weak database homology
`Q6AWW5`	Arabidopsis thaliana	Ankyrin repeat-containing protein At5g02620	24.286%	Swiss-Prot	weak database homology
`A2CIR5`	Oryza sativa subsp. japonica	Ankyrin repeat-containing protein NPR4	22.699%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card