LXL04_019229 | RubberDandelionOmics

Gene overview

LXL04_019229

Reference: OH-1004 Chr: Chr04 Coordinates: 26849630-26855978 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3114 bp · LXL04_019229|LXL04_019229|OH1004|cDNA

ATGCCGCTAAGTAGATATCAGATAAGAAATGTGTACAGTTTCGCTGATCCAGAGCTCTATAAAGCAGCAGATAAAGATGATCCCGAAGCTTTACTTGAAGGTGTTGCCATGGCAGGTGTCGTTGGCGTTATCCGTCAGCTCGGCGACCTAGCGGAATTTGCTGCTGAGATTTTCCATGAATTGCATGAAGAAGTGGCAGCAACTGCTGCAAGGAGCCATGGTCTACTGGTACGTGCTCAGCAGCTTGAGGTGGAAATCCC...

CDS

Download CDS FASTA

3114 bp · LXL04_019229|LXL04_019229|OH1004|CDS

ATGCCGCTAAGTAGATATCAGATAAGAAATGTGTACAGTTTCGCTGATCCAGAGCTCTATAAAGCAGCAGATAAAGATGATCCCGAAGCTTTACTTGAAGGTGTTGCCATGGCAGGTGTCGTTGGCGTTATCCGTCAGCTCGGCGACCTAGCGGAATTTGCTGCTGAGATTTTCCATGAATTGCATGAAGAAGTGGCAGCAACTGCTGCAAGGAGCCATGGTCTACTGGTACGTGCTCAGCAGCTTGAGGTGGAAATCCC...

Protein

Download Protein FASTA

1037 aa · LXL04_019229|LXL04_019229|OH1004|PROTEIN

MPLSRYQIRNVYSFADPELYKAADKDDPEALLEGVAMAGVVGVIRQLGDLAEFAAEIFHELHEEVAATAARSHGLLVRAQQLEVEIPSIERSFLSQKCHSTFSPNSGIDWHPNMKTTHNLITTGDLPRSVMDSYEDCRGPPRLFLLDKFDVGGEGVCLKRYTDPSFYKVEVSSYDIENAEIQREKKIRKNKKKISPWKRGGTPEVSPNSKAKLHQLFLEDRMQNGTTEPTHHVKLKKRPNKSPFDNMSKFLNSQSEGKIV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019229`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019229

Location Chr04:26849630-26855978 (-)

Description Similar to SCAR2: Protein SCAR2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g38440`	Involved in regulation of actin and microtubule organization.	DISTORTED3/SCAR2 is a putative arabidopsis WAVE complex subunit that activates the Arp2/3 complex and is required for epidermal morphogenesis.2005 · DOI: 10.1105/tpc.104.027987 IRREGULAR TRICHOME BRANCH1 in Arabidopsis encodes a plant homolog of the actin-related protein2/3 complex activator Scar/WAVE that regulates actin and microtubule organization.2005 · DOI: 10.1105/tpc.104.028670
`At5g01730`	Involved in regulation of actin and microtubule organization.	No verified direct reference in this release
`At1g29170`	Involved in regulation of actin and microtubule organization.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q84TX2`	Involved in regulation of actin and microtubule organization.	No verified direct reference in this release
`Os01g0208600`	Involved in regulation of actin and microtubule organization.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019229 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010090 trichome morphogenesis Biological Process

GO:0010091 trichome branching Biological Process

GO:0030036 actin cytoskeleton organization Biological Process

GO:0045010 actin nucleation Biological Process

GO:0051127 positive regulation of actin nucleation Biological Process

GO:0098609 cell-cell adhesion Biological Process

GO:2000601 positive regulation of Arp2/3 complex-mediated actin nucleation Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005856 cytoskeleton Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0010287 plastoglobule Cellular Component

GO:0031209 SCAR complex Cellular Component

KEGG gene cross-reference

ath:AT2G38440

ath:AT5G01730

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.447

Rank 1 · LXL04_019229 · OH-1004

Cell membrane0.369

Rank 2 · LXL04_019229 · OH-1004

Nucleus0.291

Rank 3 · LXL04_019229 · OH-1004

Endoplasmic reticulum0.066

Rank 4 · LXL04_019229 · OH-1004

Golgi apparatus0.063

Rank 5 · LXL04_019229 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27569.2SCAR_helical3-189 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019229	`PF27569.2`	SCAR_helical	3	189	7.5e-65	218.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5XPJ9`	Arabidopsis thaliana	Protein SCAR2	48.762%	Swiss-Prot	weak database homology
`Q5XPJ6`	Arabidopsis thaliana	Protein SCAR4	53.435%	Swiss-Prot	weak database homology
`Q9LP46`	Arabidopsis thaliana	Protein SCAR3	51.149%	Swiss-Prot	weak database homology
`Q84TX2`	Oryza sativa subsp. japonica	SCAR-like protein 1	52.823%	Swiss-Prot	weak database homology
`Q5QNA6`	Oryza sativa subsp. japonica	SCAR-like protein 2	45.413%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card