LXL04_019001 | RubberDandelionOmics

Gene overview

LXL04_019001

Reference: OH-1004 Chr: Chr04 Coordinates: 21640821-21644396 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

501 bp · LXL04_019001|LXL04_019001|OH1004|cDNA

ATGTTTCTaacatcaccacccactgccactaTGGCCACTATGGCCGGTgccggtggtggtggccggagaTGGACCATTGCGATTCCAACTCCGGCACACATAGGTACTACTCCTCTGTCGTTTCTTCCGTTCAATTTCAACAGGACATTCTTCATTCTATTAGATTCCGATTTGTTGAACAAAGCTATTGAATCTACTCAGGGAAGTAGCAACCATCATCCTTTTCGTCCACCAAAACCAGATGATGTGGCGACAATATG...

CDS

Download CDS FASTA

501 bp · LXL04_019001|LXL04_019001|OH1004|CDS

ATGTTTCTAACATCACCACCCACTGCCACTATGGCCACTATGGCCGGTGCCGGTGGTGGTGGCCGGAGATGGACCATTGCGATTCCAACTCCGGCACACATAGGTACTACTCCTCTGTCGTTTCTTCCGTTCAATTTCAACAGGACATTCTTCATTCTATTAGATTCCGATTTGTTGAACAAAGCTATTGAATCTACTCAGGGAAGTAGCAACCATCATCCTTTTCGTCCACCAAAACCAGATGATGTGGCGACAATATG...

Protein

Download Protein FASTA

166 aa · LXL04_019001|LXL04_019001|OH1004|PROTEIN

MFLTSPPTATMATMAGAGGGGRRWTIAIPTPAHIGTTPLSFLPFNFNRTFFILLDSDLLNKAIESTQGSSNHHPFRPPKPDDVATICYTSGTTRTPKDNLKLLDGMAELKPTVFCSVPRLYNRVYDRVMNAVKSSGGLREKLFNAAFNAKRQALLKGKNASPMWKV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019001`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019001

Location Chr04:21640821-21644396 (-)

Description Similar to LACS6: Long chain acyl-CoA synthetase 6, peroxisomal

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g05970`	Activation of long-chain fatty acids for both synthesis of cellular lipids, and degradation via beta-oxidation (Probable).	Two long-chain acyl-CoA synthetases from Arabidopsis thaliana involved in peroxisomal fatty acid beta-oxidation.2002 · DOI: 10.1046/j.1365-313x.2002.01405.x Molecular characterization of an Arabidopsis acyl-coenzyme a synthetase localized on glyoxysomal membranes.2002 · DOI: 10.1104/pp.012955 Peroxisomal Acyl-CoA synthetase activity is essential for seedling development in Arabidopsis thaliana.2004 · DOI: 10.1105/tpc.019646 Analysis of the role of COMATOSE and peroxisomal beta-oxidation in the determination of germination potential in Arabidopsis.2006 · DOI: 10.1093/jxb/erl045
`At5g27600`	Activation of long-chain fatty acids for both synthesis of cellular lipids, and degradation via beta-oxidation (Probable).	Two long-chain acyl-CoA synthetases from Arabidopsis thaliana involved in peroxisomal fatty acid beta-oxidation.2002 · DOI: 10.1046/j.1365-313x.2002.01405.x Peroxisomal Acyl-CoA synthetase activity is essential for seedling development in Arabidopsis thaliana.2004 · DOI: 10.1105/tpc.019646 Analysis of the role of COMATOSE and peroxisomal beta-oxidation in the determination of germination potential in Arabidopsis.2006 · DOI: 10.1093/jxb/erl045
`At1g49430`	Activation of long-chain fatty acids for both synthesis of cellular lipids, and degradation via beta-oxidation.	The acyl-CoA synthetase encoded by LACS2 is essential for normal cuticle development in Arabidopsis.2004 · DOI: 10.1105/tpc.017608 A permeable cuticle in Arabidopsis leads to a strong resistance to Botrytis cinerea.2007 · DOI: 10.1038/sj.emboj.7601658 Mutations in LACS2, a long-chain acyl-coenzyme A synthetase, enhance susceptibility to avirulent Pseudomonas syringae but confer resistance to Botrytis cinerea in Arabidopsis.2007 · DOI: 10.1104/pp.106.094318
`At1g64400`	Activation of long-chain fatty acids for both synthesis of cellular lipids, and degradation via beta-oxidation.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019001 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006631 fatty acid metabolic process Biological Process

GO:0006633 fatty acid biosynthetic process Biological Process

GO:0009651 response to salt stress Biological Process

GO:0010025 wax biosynthetic process Biological Process

GO:0010143 cutin biosynthetic process Biological Process

GO:0010193 response to ozone Biological Process

GO:0010311 lateral root formation Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

KEGG gene cross-reference

ath:AT1G49430

ath:AT1G64400

ath:AT3G05970

ath:AT5G27600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.271

Rank 1 · LXL04_019001 · OH-1004

Extracellular0.167

Rank 2 · LXL04_019001 · OH-1004

Cytoplasm0.154

Rank 3 · LXL04_019001 · OH-1004

Mitochondrion0.149

Rank 4 · LXL04_019001 · OH-1004

Cell membrane0.101

Rank 5 · LXL04_019001 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00501.35AMP-binding61-97 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019001	`PF00501.35`	AMP-binding	61	97	1.2e-10	41.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LPS1`	Arabidopsis thaliana	Long chain acyl-CoA synthetase 6, peroxisomal	56.977%	Swiss-Prot	moderate database homology
`Q8LKS5`	Arabidopsis thaliana	Long chain acyl-CoA synthetase 7, peroxisomal	53.731%	Swiss-Prot	weak database homology
`Q9XIA9`	Arabidopsis thaliana	Long chain acyl-CoA synthetase 2	45.312%	Swiss-Prot	weak database homology
`Q9C7W4`	Arabidopsis thaliana	Long chain acyl-CoA synthetase 3	41.538%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card