LXL04_018897 | RubberDandelionOmics

Gene overview

LXL04_018897

Reference: OH-1004 Chr: Chr04 Coordinates: 19801330-19801930 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

399 bp · LXL04_018897|LXL04_018897|OH1004|cDNA

ATGGCGCTCTCTACCTCCACCGCTAAAATTGTATCATCTTTCATTGTGGAGCAATGCTCTATTGCTTCCAGGCGTGGATATGCATCGGCGTCGCAGAATGGTGGCGTATCGGAAGTGGTGAGGGGGCGTGTGGTTACGATGATGAAGAAAGGAGGTGAAGAATCGACGAAATCGAATGCGTGGATTCCAGATCCAGTTACTGGTTACTACAAGCCAGAAGGACAAGGAAACCAGATTGATCCAGCTGAGCTTCTGGAGTT...

CDS

Download CDS FASTA

399 bp · LXL04_018897|LXL04_018897|OH1004|CDS

ATGGCGCTCTCTACCTCCACCGCTAAAATTGTATCATCTTTCATTGTGGAGCAATGCTCTATTGCTTCCAGGCGTGGATATGCATCGGCGTCGCAGAATGGTGGCGTATCGGAAGTGGTGAGGGGGCGTGTGGTTACGATGATGAAGAAAGGAGGTGAAGAATCGACGAAATCGAATGCGTGGATTCCAGATCCAGTTACTGGTTACTACAAGCCAGAAGGACAAGGAAACCAGATTGATCCAGCTGAGCTTCTGGAGTT...

Protein

Download Protein FASTA

132 aa · LXL04_018897|LXL04_018897|OH1004|PROTEIN

MALSTSTAKIVSSFIVEQCSIASRRGYASASQNGGVSEVVRGRVVTMMKKGGEESTKSNAWIPDPVTGYYKPEGQGNQIDPAELLELHKQQNAQHIHDVYPGGSDYALVNELQHDFIIVITCMFEDALSFVG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018897`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018897

Location Chr04:19801330-19801930 (+)

Description Similar to SAG21: Protein SENESCENCE-ASSOCIATED GENE 21, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g02380`	Mediates tolerance to oxidative stresses (e.g. hydrogen peroxide H(2)O(2), diamide, menadione and tert-butyl hydroperoxide) by minimizing the negative effects of oxidation and monitoring photosynthesis during stress.	Yeast complementation reveals a role for an Arabidopsis thaliana late embryogenesis abundant (LEA)-like protein in oxidative stress tolerance.2006 · DOI: 10.1111/j.1365-313x.2006.02911.x
`At1g02820`	Late embryogenis abundant protein 2.	No verified direct reference in this release
`At4g15910`	Late embryogenis abundant protein 41.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018897 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000302 response to reactive oxygen species Biological Process

GO:0006950 response to stress Biological Process

GO:0006952 defense response Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009611 response to wounding Biological Process

GO:0009620 response to fungus Biological Process

GO:0009625 response to insect Biological Process

GO:0009631 cold acclimation Biological Process

GO:0009646 response to absence of light Biological Process

KEGG gene cross-reference

ath:AT1G02820

ath:AT4G02380

ath:AT4G15910

cit:102610022

ghi:107916177

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.819

Rank 1 · LXL04_018897 · OH-1004

Plastid0.080

Rank 2 · LXL04_018897 · OH-1004

Nucleus0.076

Rank 3 · LXL04_018897 · OH-1004

Cytoplasm0.071

Rank 4 · LXL04_018897 · OH-1004

Cell membrane0.014

Rank 5 · LXL04_018897 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03242.19LEA_3a1-87 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018897	`PF03242.19`	LEA_3a	1	87	7.3e-24	84.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93WF6`	Arabidopsis thaliana	Protein SENESCENCE-ASSOCIATED GENE 21, mitochondrial	51.136%	Swiss-Prot	moderate database homology
`Q9SRX6`	Arabidopsis thaliana	Late embryogenis abundant protein 2	45.455%	Swiss-Prot	moderate database homology
`Q39084`	Arabidopsis thaliana	Late embryogenis abundant protein 41	43.902%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card