LXL04_018590 | RubberDandelionOmics

Gene overview

LXL04_018590

Reference: OH-1004 Chr: Chr04 Coordinates: 15277628-15281396 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1155 bp · LXL04_018590|LXL04_018590|OH1004|cDNA

ATGCTAACATGCATTGCTCGTTCGAAGCAGCCTGACGAAGCTGATGAATCAAACCGCATTAATGACGGCAGTACTCCTGCCAATAAACAAGCCATCAAAACGCTGACATCTCAGATCAAGGATATCGCGCTTAAAGCCTCTGGATCAGCGTATCGGAGCTGCAATCCTTGTACAGGAGCCACGATGATGATGACTCCGCAACAGCAGTTGCAAAAGAGCAACGATGTGCAACCGGACTTGTCGACGTCTGTGTCGGACAG...

CDS

Download CDS FASTA

1155 bp · LXL04_018590|LXL04_018590|OH1004|CDS

ATGCTAACATGCATTGCTCGTTCGAAGCAGCCTGACGAAGCTGATGAATCAAACCGCATTAATGACGGCAGTACTCCTGCCAATAAACAAGCCATCAAAACGCTGACATCTCAGATCAAGGATATCGCGCTTAAAGCCTCTGGATCAGCGTATCGGAGCTGCAATCCTTGTACAGGAGCCACGATGATGATGACTCCGCAACAGCAGTTGCAAAAGAGCAACGATGTGCAACCGGACTTGTCGACGTCTGTGTCGGACAG...

Protein

Download Protein FASTA

384 aa · LXL04_018590|LXL04_018590|OH1004|PROTEIN

MLTCIARSKQPDEADESNRINDGSTPANKQAIKTLTSQIKDIALKASGSAYRSCNPCTGATMMMTPQQQLQKSNDVQPDLSTSVSDRFRWSYRRNGSKNSSSGRVWGKELEARLKGISVGSGVGGDVSVGTLSASASGRRPDPIVLEDESEPKEWIAQVEPGVLITFVSLPRGGNDLKRIRFSREMFNKWQAQKWWQENYDKVMELYNVQRLNRESFPLPTPPRSEDESSSLKFECIGGDNDSPITPPLNRERLPRTLYR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018590`
TK1151 ID	TkA08G069800
OH-1004 ID	LXL04_018590
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018590

Location Chr04:15277628-15281396 (-)

Description Similar to BRXL4: Protein Brevis radix-like 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g20540`	Protein Brevis radix-like 4.	No verified direct reference in this release
`At3g14000`	Protein Brevis radix-like 2.	No verified direct reference in this release
`At1g54180`	Protein Brevis radix-like 3.	No verified direct reference in this release
`At1g31880`	Acts as a regulator of cell proliferation and elongation in the root and shoot.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0462700`	Protein Brevis radix-like 1.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018590 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0009736 cytokinin-activated signaling pathway Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0010078 maintenance of root meristem identity Biological Process

GO:0010088 phloem development Biological Process

GO:0010315 auxin export across the plasma membrane Biological Process

GO:0010440 stomatal lineage progression Biological Process

GO:0030154 cell differentiation Biological Process

GO:0048364 root development Biological Process

GO:0048527 lateral root development Biological Process

GO:0048756 sieve cell differentiation Biological Process

GO:2000280 regulation of root development Biological Process

KEGG gene cross-reference

ath:AT1G31880

ath:AT1G54180

ath:AT3G14000

ath:AT5G20540

dosa:Os08g0462700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.312

Rank 1 · LXL04_018590 · OH-1004

Cytoplasm0.301

Rank 2 · LXL04_018590 · OH-1004

Cell membrane0.298

Rank 3 · LXL04_018590 · OH-1004

Plastid0.200

Rank 4 · LXL04_018590 · OH-1004

Mitochondrion0.043

Rank 5 · LXL04_018590 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13713.12BRX_N25-57 aa

PF08381.17BRX153-207 aa

PF08381.17BRX328-383 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018590	`PF13713.12`	BRX_N	25	57	1.1e-12	48.1
LXL04_018590	`PF08381.17`	BRX	153	207	2.7e-55	184.3
LXL04_018590	`PF08381.17`	BRX	328	383	2.7e-55	184.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GZ92`	Arabidopsis thaliana	Protein Brevis radix-like 4	60.147%	Swiss-Prot	strong database homology
`Q8GYL9`	Arabidopsis thaliana	Protein Brevis radix-like 2	55.181%	Swiss-Prot	strong database homology
`Q5HZ09`	Arabidopsis thaliana	Protein Brevis radix-like 3	50.704%	Swiss-Prot	strong database homology
`Q17TI5`	Arabidopsis thaliana	Protein BREVIS RADIX	43.511%	Swiss-Prot	moderate database homology
`Q6YUB8`	Oryza sativa subsp. japonica	Protein Brevis radix-like 1	51.529%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card