LXL04_018564 | RubberDandelionOmics

Gene overview

LXL04_018564

Reference: OH-1004 Chr: Chr04 Coordinates: 14703811-14704176 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

366 bp · LXL04_018564|LXL04_018564|OH1004|cDNA

ATGGCGAAAGGTGGAAAGCTAATGAAGATAAAGTCGGTGCTAAAGAAGTGGCATTCATTTGGGAACGGCAAGTCGTCGTCAGGTGGTGCAATCAAGGGCGGCGGCGGCGACGATGAAGTGGAGGTCGACGACTACCAGAATTTGAGCAATTCTCAAGCTGTTTTCGTCGGAAAGTCCCGGCGGCGGTACCTTATAAGCTCCGATGTTGCTCAACATCCGTTGATTCAAGAGCTTGTTGAACGTTCCGGCGATAATGTGAC...

CDS

Download CDS FASTA

366 bp · LXL04_018564|LXL04_018564|OH1004|CDS

ATGGCGAAAGGTGGAAAGCTAATGAAGATAAAGTCGGTGCTAAAGAAGTGGCATTCATTTGGGAACGGCAAGTCGTCGTCAGGTGGTGCAATCAAGGGCGGCGGCGGCGACGATGAAGTGGAGGTCGACGACTACCAGAATTTGAGCAATTCTCAAGCTGTTTTCGTCGGAAAGTCCCGGCGGCGGTACCTTATAAGCTCCGATGTTGCTCAACATCCGTTGATTCAAGAGCTTGTTGAACGTTCCGGCGATAATGTGAC...

Protein

Download Protein FASTA

121 aa · LXL04_018564|LXL04_018564|OH1004|PROTEIN

MAKGGKLMKIKSVLKKWHSFGNGKSSSGGAIKGGGGDDEVEVDDYQNLSNSQAVFVGKSRRRYLISSDVAQHPLIQELVERSGDNVTIDCEVVLFEHLLWMIENADPQPDALHELVDFYAC

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018564`
TK1151 ID	TkA08G068250
OH-1004 ID	LXL04_018564
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	87.700
Protein coverage (%)	TK1151 100.000 / OH-1004 94.215 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018564

Location Chr04:14703811-14704176 (+)

Description Similar to SAUR76: Auxin-responsive protein SAUR76

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g20820`	May be involved in the regulation of ethylene receptor signaling.	Characterization of a small auxin-up RNA (SAUR)-like gene involved in Arabidopsis thaliana development.2013 · DOI: 10.1371/journal.pone.0082596
`At1g72430`	May be involved in the regulation of ethylene receptor signaling.	No verified direct reference in this release
`At1g17345`	May be involved in the regulation of ethylene receptor signaling.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018564 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009733 response to auxin Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G17345

ath:AT1G72430

ath:AT5G20820

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.546

Rank 1 · LXL04_018564 · OH-1004

Nucleus0.378

Rank 2 · LXL04_018564 · OH-1004

Cell membrane0.244

Rank 3 · LXL04_018564 · OH-1004

Endoplasmic reticulum0.072

Rank 4 · LXL04_018564 · OH-1004

Plastid0.032

Rank 5 · LXL04_018564 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02519.21Auxin_inducible9-106 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018564	`PF02519.21`	Auxin_inducible	9	106	9.9e-16	58.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q29PU2`	Arabidopsis thaliana	Auxin-responsive protein SAUR76	48.092%	Swiss-Prot	moderate database homology
`Q9C9E1`	Arabidopsis thaliana	Auxin-responsive protein SAUR78	41.085%	Swiss-Prot	moderate database homology
`Q9LQI6`	Arabidopsis thaliana	Auxin-responsive protein SAUR77	37.956%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card