Gene Card
Gene overview
cDNA / CDS / Protein Sequences
708 bp · LXL04_018542|LXL04_018542|OH1004|cDNA
ATGGCGGGAATGGCGCAGCTGATGGTAACAGACACGATAATGTCATTTATGTGGGTTTGGTCAGGCATTACCATCAGAGTAATTACTCACATTGTTCTAGGGCTGAGCATCAATGGCCACGCATCTGAAATCGTTCGGTCTTCACTCACCATTGCCAACATGTTTTTGTTTACAAATTTGACCAAACTCACCAATGGCGGAGCGTACAATCCCATCGTTGTCTTCACCTCTGCCATCAACGGCGATTTCACCAACTTTCT...
708 bp · LXL04_018542|LXL04_018542|OH1004|CDS
ATGGCGGGAATGGCGCAGCTGATGGTAACAGACACGATAATGTCATTTATGTGGGTTTGGTCAGGCATTACCATCAGAGTAATTACTCACATTGTTCTAGGGCTGAGCATCAATGGCCACGCATCTGAAATCGTTCGGTCTTCACTCACCATTGCCAACATGTTTTTGTTTACAAATTTGACCAAACTCACCAATGGCGGAGCGTACAATCCCATCGTTGTCTTCACCTCTGCCATCAACGGCGATTTCACCAACTTTCT...
Protein
Download Protein FASTA235 aa · LXL04_018542|LXL04_018542|OH1004|PROTEIN
MAGMAQLMVTDTIMSFMWVWSGITIRVITHIVLGLSINGHASEIVRSSLTIANMFLFTNLTKLTNGGAYNPIVVFTSAINGDFTNFLFNIGRIPFQVIGAIAGVRLIIETFPELWRGPQLVINLHHGALTEGLLTFSQVLITLGLDRSINGSFYMKTWISSILKFSLHILGSDLTGGCMNPAAVVGWAYAFGVHKGKEHIIVYWFAPFEAAVLASWTFRWLTRRPKPVKKKKKTN
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_018542 |
|---|---|
| TK1151 ID | TkA08G066810 |
| OH-1004 ID | LXL04_018542 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_018542 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr04:14355946-14356814 (-) | ||||||||||||
| Description | Similar to SIP2-1: Probable aquaporin SIP2-1 | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0009846 pollen germination Biological Process GO:0009860 pollen tube growth Biological Process GO:0005576 extracellular region Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005783 endoplasmic reticulum Cellular Component GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0012505 endomembrane system Cellular Component GO:0016020 membrane Cellular Component GO:0015250 water channel activity Molecular Function GO:0015267 channel activity Molecular Function | ||||||||||||
| KEGG gene cross-reference | ath:AT3G56950 dosa:Os03g0320000 zma:541892 zma:542494 zma:542646 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00230.26MIP8-217 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_018542 | PF00230.26 | MIP | 8 | 217 | 1.1e-07 | 32.6 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.