LXL04_018538 | RubberDandelionOmics

Gene overview

LXL04_018538

Reference: OH-1004 Chr: Chr04 Coordinates: 14334488-14337262 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1710 bp · LXL04_018538|LXL04_018538|OH1004|cDNA

ATGAGCAGCAGGAAGGAGGAAGAGCGAAATGAGAAAATTATCAGGGGTTTAATGAAGCTTCCTCCTAATCGAAGATGCATCAATTGCAACAGCTTGGGACCTCAATACGTATGCACTAATTTCTGGACTTTCGTTTGCATGACATGTAGCGGAATACACCGTGAGTTCACTCACCGTGTCAAATCAGTATCAATGTCCAAATTCACTTCACAAGAAGTCGAATCCCTTCAAGAAGGTGGTAATCAGCGTGCAAGAGAAAC...

CDS

Download CDS FASTA

1710 bp · LXL04_018538|LXL04_018538|OH1004|CDS

ATGAGCAGCAGGAAGGAGGAAGAGCGAAATGAGAAAATTATCAGGGGTTTAATGAAGCTTCCTCCTAATCGAAGATGCATCAATTGCAACAGCTTGGGACCTCAATACGTATGCACTAATTTCTGGACTTTCGTTTGCATGACATGTAGCGGAATACACCGTGAGTTCACTCACCGTGTCAAATCAGTATCAATGTCCAAATTCACTTCACAAGAAGTCGAATCCCTTCAAGAAGGTGGTAATCAGCGTGCAAGAGAAAC...

Protein

Download Protein FASTA

569 aa · LXL04_018538|LXL04_018538|OH1004|PROTEIN

MSSRKEEERNEKIIRGLMKLPPNRRCINCNSLGPQYVCTNFWTFVCMTCSGIHREFTHRVKSVSMSKFTSQEVESLQEGGNQRARETFLKDWDPREQRLPDNSNVDKVREFIKSVYVDKKFFASKASGKPPRDTLGVRNNEDETRRASSYHSYSQSPPYDYQYEERRYGKQAPSLTKKPGSDRGMLRFLSTSRLSDHVQEDDRFANDVANTKARVSDFSGTQSPTFQSEIGFSSLSREMSKDNLTEDVQKLKTGSSDTLS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018538`
TK1151 ID	TkA08G066730
OH-1004 ID	LXL04_018538
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018538

Location Chr04:14334488-14337262 (-)

Description Similar to AGD14: Probable ADP-ribosylation factor GTPase-activating protein AGD14

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q8RXE7`	GTPase-activating protein (GAP) for ADP ribosylation factor (ARF).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018538 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0001675 acrosome assembly Biological Process

GO:0006406 mRNA export from nucleus Biological Process

GO:0007289 spermatid nucleus differentiation Biological Process

GO:0045109 intermediate filament organization Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005643 nuclear pore Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0031410 cytoplasmic vesicle Cellular Component

GO:0042995 cell projection Cellular Component

GO:0003677 DNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G08680

bta:536149

hsa:3267

mmu:15463

rno:363266

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.565

Rank 1 · LXL04_018538 · OH-1004

Golgi apparatus0.230

Rank 2 · LXL04_018538 · OH-1004

Cell membrane0.199

Rank 3 · LXL04_018538 · OH-1004

Nucleus0.184

Rank 4 · LXL04_018538 · OH-1004

Endoplasmic reticulum0.082

Rank 5 · LXL04_018538 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01412.24ArfGap12-123 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018538	`PF01412.24`	ArfGap	12	123	9.8e-31	107.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RXE7`	Arabidopsis thaliana	Probable ADP-ribosylation factor GTPase-activating protein AGD14	38.938%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card