LXL04_018524 | RubberDandelionOmics

Gene overview

LXL04_018524

Reference: OH-1004 Chr: Chr04 Coordinates: 14262922-14264639 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

948 bp · LXL04_018524|LXL04_018524|OH1004|cDNA

ATGGCGACTGAAATTCGATCATTTGATCTGATGAACAAGACCCAGATTCCATCGGTAGGTCTCGGAACATGGCAATCGGAACCTGGTCTTGTTGGCGAAGCCGTTACAGCTGCCGTCAAGGCTGGGTACCGCCATATTGATTGTGCTCAAGTTTATGGCAACGAAAAAGAGATTGGTTTAGCTTTAAAGAAGCTCTTTGAAGATGGCGTGGTGGCTCGTGAAGATTTATGGATAACCTCCAAACTCTGGTGTAATAATCA...

CDS

Download CDS FASTA

948 bp · LXL04_018524|LXL04_018524|OH1004|CDS

ATGGCGACTGAAATTCGATCATTTGATCTGATGAACAAGACCCAGATTCCATCGGTAGGTCTCGGAACATGGCAATCGGAACCTGGTCTTGTTGGCGAAGCCGTTACAGCTGCCGTCAAGGCTGGGTACCGCCATATTGATTGTGCTCAAGTTTATGGCAACGAAAAAGAGATTGGTTTAGCTTTAAAGAAGCTCTTTGAAGATGGCGTGGTGGCTCGTGAAGATTTATGGATAACCTCCAAACTCTGGTGTAATAATCA...

Protein

Download Protein FASTA

315 aa · LXL04_018524|LXL04_018524|OH1004|PROTEIN

MATEIRSFDLMNKTQIPSVGLGTWQSEPGLVGEAVTAAVKAGYRHIDCAQVYGNEKEIGLALKKLFEDGVVAREDLWITSKLWCNNHAPEDVPVALNKTLNDLQVDYLDLYLIHWPVRTKKGTAGFQPENLLKTDIPATWKALEALYDIGRTRGLGVSNFSSKKLGDLLKIARIPPIVNQVECHPSWQQTKLREFCKSKGVHLSGYSPLGSPGTKWLKSSVLEHPILTSIADKLGKTPAQVAIRWGLQMGNSVLPKSTNE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018524`
TK1151 ID	TkA08G066480
OH-1004 ID	LXL04_018524
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018524

Location Chr04:14262922-14264639 (+)

Description Similar to AKR4C9: NADPH-dependent aldo-keto reductase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g37770`	Oxidoreductase acting on a broad range of substrates: reduces ketosteroids, aromatic aldehydes, ketones, sugars and other aliphatic aldehydes, and oxidizes hydroxysteroids.	Characterization of two novel aldo-keto reductases from Arabidopsis: expression patterns, broad substrate specificity, and an open active-site structure suggest a role in toxicant metabolism following stress.2009 · DOI: 10.1016/j.jmb.2009.07.023 NADPH-dependent reductases involved in the detoxification of reactive carbonyls in plants.2011 · DOI: 10.1074/jbc.m110.202226
`At2g37790`	Oxidoreductase that may act on a broad range of substrates such as ketosteroids, aldehydes, ketones and sugars.	No verified direct reference in this release
`At3g53880`	Oxidoreductase that may act on a broad range of substrates such as ketosteroids, aldehydes, ketones and sugars.	No verified direct reference in this release
`At2g37760`	Oxidoreductase acting on a broad range of substrates: reduces ketosteroids, aromatic aldehydes, ketones, sugars and other aliphatic aldehydes, and oxidizes hydroxysteroids.	Characterization of two novel aldo-keto reductases from Arabidopsis: expression patterns, broad substrate specificity, and an open active-site structure suggest a role in toxicant metabolism following stress.2009 · DOI: 10.1016/j.jmb.2009.07.023

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018524 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009636 response to toxic substance Biological Process

GO:0009651 response to salt stress Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004032 aldose reductase (NADPH) activity Molecular Function

GO:0008106 alcohol dehydrogenase (NADP+) activity Molecular Function

GO:0016229 steroid dehydrogenase activity Molecular Function

GO:0070401 NADP+ binding Molecular Function

KEGG gene cross-reference

ath:AT2G37760

ath:AT2G37770

ath:AT2G37790

ath:AT3G53880

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.545

Rank 1 · LXL04_018524 · OH-1004

Plastid0.300

Rank 2 · LXL04_018524 · OH-1004

Nucleus0.186

Rank 3 · LXL04_018524 · OH-1004

Peroxisome0.134

Rank 4 · LXL04_018524 · OH-1004

Mitochondrion0.094

Rank 5 · LXL04_018524 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00248.28Aldo_ket_red19-285 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018524	`PF00248.28`	Aldo_ket_red	19	285	1.1e-52	179.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0PGJ6`	Arabidopsis thaliana	NADPH-dependent aldo-keto reductase, chloroplastic	72.381%	Swiss-Prot	strong database homology
`Q84TF0`	Arabidopsis thaliana	Aldo-keto reductase family 4 member C10	71.429%	Swiss-Prot	strong database homology
`Q9M338`	Arabidopsis thaliana	Aldo-keto reductase family 4 member C11	65.714%	Swiss-Prot	strong database homology
`O80944`	Arabidopsis thaliana	Aldo-keto reductase family 4 member C8	61.270%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card