LXL04_018485 | RubberDandelionOmics

Gene overview

LXL04_018485

Reference: OH-1004 Chr: Chr04 Coordinates: 13614140-13615493 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1197 bp · LXL04_018485|LXL04_018485|OH1004|cDNA

ATGACAATCAAACGCTCACACGTTCGAACCTCCAATCAAAGATTCAACAAGTATCTCGCCCCTTTCTGCATTCTATTAATCGCACTCTCTCTCATCCTTTTCCTCGCTCTAAAATCATCCCCACATTCCACTTCCAATACCCTTTCAAAAAACGGCGCTGCTTCCATTTCAACCTCCGACGCATCCAATAACTTGCCGGAGGTTCCTCGGTTTGCGTACTTCATCACGGGTACGATAGGAGACGGTGCTCGTCTGCACCG...

CDS

Download CDS FASTA

1197 bp · LXL04_018485|LXL04_018485|OH1004|CDS

ATGACAATCAAACGCTCACACGTTCGAACCTCCAATCAAAGATTCAACAAGTATCTCGCCCCTTTCTGCATTCTATTAATCGCACTCTCTCTCATCCTTTTCCTCGCTCTAAAATCATCCCCACATTCCACTTCCAATACCCTTTCAAAAAACGGCGCTGCTTCCATTTCAACCTCCGACGCATCCAATAACTTGCCGGAGGTTCCTCGGTTTGCGTACTTCATCACGGGTACGATAGGAGACGGTGCTCGTCTGCACCG...

Protein

Download Protein FASTA

398 aa · LXL04_018485|LXL04_018485|OH1004|PROTEIN

MTIKRSHVRTSNQRFNKYLAPFCILLIALSLILFLALKSSPHSTSNTLSKNGAASISTSDASNNLPEVPRFAYFITGTIGDGARLHRLLRAVYHPRNYYLLHLDLEASDAERVDLAKNFKEVKNVMVVGKANLVTSKGPTMVACMLHAIALLLKQGKDWNWFINLSASDYPLMPQDDILHIFSYLPRDLNFLEHTTNIGWKEFQRARPIIIDPGLYHSKKSGVFWAKEKRSMPSSFKLFMGSSWVVLTRPFLEFCIWGWD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018485`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018485

Location Chr04:13614140-13615493 (+)

Description Similar to GLCAT14C: Beta-glucuronosyltransferase GlcAT14C

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g37585`	Beta-glucuronosyltransferase involved in the biosynthesis of type II arabinogalactan (AG).	Arabidopsis thaliana glucuronosyltransferase in family GT14.2014 · DOI: 10.4161/psb.28891
`At5g39990`	Beta-glucuronosyltransferase involved in the biosynthesis of type II arabinogalactan (AG).	A β-glucuronosyltransferase from Arabidopsis thaliana involved in biosynthesis of type II arabinogalactan has a role in cell elongation during seedling growth.2013 · DOI: 10.1111/tpj.12353
`At5g15050`	Beta-glucuronosyltransferase involved in the biosynthesis of type II arabinogalactan (AG).	Arabidopsis thaliana glucuronosyltransferase in family GT14.2014 · DOI: 10.4161/psb.28891

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018485 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009826 unidimensional cell growth Biological Process

GO:0015012 heparan sulfate proteoglycan biosynthetic process Biological Process

GO:0050650 chondroitin sulfate proteoglycan biosynthetic process Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005615 extracellular space Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0000287 magnesium ion binding Molecular Function

GO:0015020 glucuronosyltransferase activity Molecular Function

GO:0030145 manganese ion binding Molecular Function

GO:0030158 protein xylosyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT2G37585

ath:AT5G15050

ath:AT5G39990

cin:619275

ptr:455118

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.732

Rank 1 · LXL04_018485 · OH-1004

Endoplasmic reticulum0.069

Rank 2 · LXL04_018485 · OH-1004

Cell membrane0.067

Rank 3 · LXL04_018485 · OH-1004

Cytoplasm0.037

Rank 4 · LXL04_018485 · OH-1004

Extracellular0.036

Rank 5 · LXL04_018485 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02485.28Branch71-324 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018485	`PF02485.28`	Branch	71	324	1e-72	245.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8S8P3`	Arabidopsis thaliana	Beta-glucuronosyltransferase GlcAT14C	70.833%	Swiss-Prot	strong database homology
`Q9FLD7`	Arabidopsis thaliana	Beta-glucuronosyltransferase GlcAT14A	59.718%	Swiss-Prot	strong database homology
`Q9LFQ0`	Arabidopsis thaliana	Beta-glucuronosyltransferase GlcAT14B	59.483%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card